FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634343_at:

>probe:Drosophila_2:1634343_at:520:633; Interrogation_Position=1036; Antisense; TCGATGTCTTGGATCAGGCATTACT
>probe:Drosophila_2:1634343_at:661:273; Interrogation_Position=1054; Antisense; CATTACTGCGTCCTGGTCGAATTGA
>probe:Drosophila_2:1634343_at:194:11; Interrogation_Position=1138; Antisense; ATTCTCGCAAGATGAACCTCACCAG
>probe:Drosophila_2:1634343_at:107:651; Interrogation_Position=1156; Antisense; TCACCAGAGGCATCAATCTTCGCAA
>probe:Drosophila_2:1634343_at:157:355; Interrogation_Position=1231; Antisense; GCACCGAGGCGGGAATGTATGCTCT
>probe:Drosophila_2:1634343_at:155:561; Interrogation_Position=1259; Antisense; GGAAAGACGGGTCCATGTCACCCAG
>probe:Drosophila_2:1634343_at:257:73; Interrogation_Position=1285; Antisense; AGGACTTTGAAATGGCCGTCTCCAA
>probe:Drosophila_2:1634343_at:330:393; Interrogation_Position=1391; Antisense; GAAAGCTCCATTATCAGACTGAATA
>probe:Drosophila_2:1634343_at:661:507; Interrogation_Position=852; Antisense; GTGATGGCTAGGGAACACGCTCCAT
>probe:Drosophila_2:1634343_at:326:187; Interrogation_Position=865; Antisense; AACACGCTCCATCCATAATATTCAT
>probe:Drosophila_2:1634343_at:517:97; Interrogation_Position=895; Antisense; AGATCGACTCGATTGGTTCCGCTCG
>probe:Drosophila_2:1634343_at:108:463; Interrogation_Position=939; Antisense; GATTCGGAGGTCCAGCGAACCATGC
>probe:Drosophila_2:1634343_at:132:379; Interrogation_Position=955; Antisense; GAACCATGCTGGAGCTTCTGAACCA
>probe:Drosophila_2:1634343_at:152:195; Interrogation_Position=979; Antisense; AACTGGACGGCTTCGAGGCTACTAA

Paste this into a BLAST search page for me
TCGATGTCTTGGATCAGGCATTACTCATTACTGCGTCCTGGTCGAATTGAATTCTCGCAAGATGAACCTCACCAGTCACCAGAGGCATCAATCTTCGCAAGCACCGAGGCGGGAATGTATGCTCTGGAAAGACGGGTCCATGTCACCCAGAGGACTTTGAAATGGCCGTCTCCAAGAAAGCTCCATTATCAGACTGAATAGTGATGGCTAGGGAACACGCTCCATAACACGCTCCATCCATAATATTCATAGATCGACTCGATTGGTTCCGCTCGGATTCGGAGGTCCAGCGAACCATGCGAACCATGCTGGAGCTTCTGAACCAAACTGGACGGCTTCGAGGCTACTAA

Full Affymetrix probeset data:

Annotations for 1634343_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720