FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634344_at:

>probe:Drosophila_2:1634344_at:285:249; Interrogation_Position=1817; Antisense; AATTGGGCGTAATCTGCTTGGGACT
>probe:Drosophila_2:1634344_at:295:77; Interrogation_Position=1846; Antisense; AGGATGTCGGCCAAGCCAGTATCGA
>probe:Drosophila_2:1634344_at:179:71; Interrogation_Position=1879; Antisense; AGGCGATCGCATACGTCGACTTGAA
>probe:Drosophila_2:1634344_at:567:267; Interrogation_Position=1922; Antisense; CAGTGGAGTTGTCCTTCAGCTGGAT
>probe:Drosophila_2:1634344_at:368:589; Interrogation_Position=1942; Antisense; TGGATGCCGGCATCTTGAGCCTTGT
>probe:Drosophila_2:1634344_at:7:261; Interrogation_Position=1982; Antisense; CACCGGATGGTGTCTTTTGGTCCTG
>probe:Drosophila_2:1634344_at:472:729; Interrogation_Position=1998; Antisense; TTGGTCCTGTGGCTGCACATCGATG
>probe:Drosophila_2:1634344_at:729:151; Interrogation_Position=2014; Antisense; ACATCGATGGGCAGCTTGTTGGCCT
>probe:Drosophila_2:1634344_at:256:457; Interrogation_Position=2048; Antisense; GATACGGATGCAGCTTTGGCGACTT
>probe:Drosophila_2:1634344_at:228:723; Interrogation_Position=2063; Antisense; TTGGCGACTTCTCCGTCGAATTAAT
>probe:Drosophila_2:1634344_at:313:725; Interrogation_Position=2098; Antisense; TTGAGTGTGGCAGCAACACCAGCCT
>probe:Drosophila_2:1634344_at:665:185; Interrogation_Position=2112; Antisense; AACACCAGCCTTCCATCTAAAGGGA
>probe:Drosophila_2:1634344_at:717:1; Interrogation_Position=2160; Antisense; ATTTAAACCTGACACTGGCAAGTAA
>probe:Drosophila_2:1634344_at:603:487; Interrogation_Position=2205; Antisense; GTACCATTCACCTGCGCAATTATTA

Paste this into a BLAST search page for me
AATTGGGCGTAATCTGCTTGGGACTAGGATGTCGGCCAAGCCAGTATCGAAGGCGATCGCATACGTCGACTTGAACAGTGGAGTTGTCCTTCAGCTGGATTGGATGCCGGCATCTTGAGCCTTGTCACCGGATGGTGTCTTTTGGTCCTGTTGGTCCTGTGGCTGCACATCGATGACATCGATGGGCAGCTTGTTGGCCTGATACGGATGCAGCTTTGGCGACTTTTGGCGACTTCTCCGTCGAATTAATTTGAGTGTGGCAGCAACACCAGCCTAACACCAGCCTTCCATCTAAAGGGAATTTAAACCTGACACTGGCAAGTAAGTACCATTCACCTGCGCAATTATTA

Full Affymetrix probeset data:

Annotations for 1634344_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720