FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634345_at:

>probe:Drosophila_2:1634345_at:303:89; Interrogation_Position=170; Antisense; AGTCAGCGCCCACGGTTGTGAGTCA
>probe:Drosophila_2:1634345_at:366:729; Interrogation_Position=185; Antisense; TTGTGAGTCACGTGCTCCAGCAGGC
>probe:Drosophila_2:1634345_at:237:685; Interrogation_Position=217; Antisense; TATCTGGAGCGTTTGCATGGAGCAC
>probe:Drosophila_2:1634345_at:327:553; Interrogation_Position=235; Antisense; GGAGCACGCGATTCCGCCGAGGAAA
>probe:Drosophila_2:1634345_at:408:675; Interrogation_Position=300; Antisense; TAGCAGCGATACCAGCGAAGCGGCC
>probe:Drosophila_2:1634345_at:692:205; Interrogation_Position=317; Antisense; AAGCGGCCGTACTCGATTTGGATGC
>probe:Drosophila_2:1634345_at:508:53; Interrogation_Position=347; Antisense; ATGCAAGTGCTGATGAACCGGCGGC
>probe:Drosophila_2:1634345_at:434:567; Interrogation_Position=366; Antisense; GGCGGCAAATGCTGGCCCAATCGTG
>probe:Drosophila_2:1634345_at:211:579; Interrogation_Position=390; Antisense; GGCCAGTTCGCCAAGTATTCTAATT
>probe:Drosophila_2:1634345_at:398:455; Interrogation_Position=523; Antisense; GATAAGAACTGCAGCTCCATGGAGC
>probe:Drosophila_2:1634345_at:257:423; Interrogation_Position=562; Antisense; GAGAAGCAACGCTGGCTACTCATAT
>probe:Drosophila_2:1634345_at:619:85; Interrogation_Position=590; Antisense; AGTGCAGTGCACTTTTCGACGAGGG
>probe:Drosophila_2:1634345_at:605:717; Interrogation_Position=640; Antisense; TTCCGCAAGCTATTCCTGGACGAGG
>probe:Drosophila_2:1634345_at:552:73; Interrogation_Position=662; Antisense; AGGTGAGTCCGTCCCTAAATGTTAT

Paste this into a BLAST search page for me
AGTCAGCGCCCACGGTTGTGAGTCATTGTGAGTCACGTGCTCCAGCAGGCTATCTGGAGCGTTTGCATGGAGCACGGAGCACGCGATTCCGCCGAGGAAATAGCAGCGATACCAGCGAAGCGGCCAAGCGGCCGTACTCGATTTGGATGCATGCAAGTGCTGATGAACCGGCGGCGGCGGCAAATGCTGGCCCAATCGTGGGCCAGTTCGCCAAGTATTCTAATTGATAAGAACTGCAGCTCCATGGAGCGAGAAGCAACGCTGGCTACTCATATAGTGCAGTGCACTTTTCGACGAGGGTTCCGCAAGCTATTCCTGGACGAGGAGGTGAGTCCGTCCCTAAATGTTAT

Full Affymetrix probeset data:

Annotations for 1634345_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720