FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634346_at:

>probe:Drosophila_2:1634346_at:422:545; Interrogation_Position=114; Antisense; GGATCAGCAGAAATCGGCCCTGTAT
>probe:Drosophila_2:1634346_at:707:281; Interrogation_Position=133; Antisense; CTGTATCCAGCAGCCGGCTTTAAGC
>probe:Drosophila_2:1634346_at:143:569; Interrogation_Position=148; Antisense; GGCTTTAAGCCCTCTAGACAGTTTG
>probe:Drosophila_2:1634346_at:286:643; Interrogation_Position=160; Antisense; TCTAGACAGTTTGGCCTTCCGGCAA
>probe:Drosophila_2:1634346_at:161:649; Interrogation_Position=20; Antisense; TCAGCTCGACTGTTGTCTGTCTTCT
>probe:Drosophila_2:1634346_at:678:633; Interrogation_Position=207; Antisense; TCGCCTTGTGGCCAACAGTGAAGCG
>probe:Drosophila_2:1634346_at:388:77; Interrogation_Position=233; Antisense; AGGAGGATCTCGACGACGCCGCCGA
>probe:Drosophila_2:1634346_at:168:173; Interrogation_Position=279; Antisense; AAAGACAGTTTCTGTGCCACGCCTA
>probe:Drosophila_2:1634346_at:545:629; Interrogation_Position=312; Antisense; TCCAGGGCCAGCATTACCGGTAACT
>probe:Drosophila_2:1634346_at:184:129; Interrogation_Position=340; Antisense; ACCATCGCATACTATCCGGCCGAAG
>probe:Drosophila_2:1634346_at:590:379; Interrogation_Position=361; Antisense; GAAGCCGTGGGATTCGTCCAGCCAT
>probe:Drosophila_2:1634346_at:595:191; Interrogation_Position=387; Antisense; AACTTTCGCCAAGTTCATCGGTGGC
>probe:Drosophila_2:1634346_at:596:71; Interrogation_Position=419; Antisense; AGGCTGCACCATATGTAGCTGCGTC
>probe:Drosophila_2:1634346_at:527:501; Interrogation_Position=441; Antisense; GTCGCAGTACTACCAAGCCTATTTT

Paste this into a BLAST search page for me
GGATCAGCAGAAATCGGCCCTGTATCTGTATCCAGCAGCCGGCTTTAAGCGGCTTTAAGCCCTCTAGACAGTTTGTCTAGACAGTTTGGCCTTCCGGCAATCAGCTCGACTGTTGTCTGTCTTCTTCGCCTTGTGGCCAACAGTGAAGCGAGGAGGATCTCGACGACGCCGCCGAAAAGACAGTTTCTGTGCCACGCCTATCCAGGGCCAGCATTACCGGTAACTACCATCGCATACTATCCGGCCGAAGGAAGCCGTGGGATTCGTCCAGCCATAACTTTCGCCAAGTTCATCGGTGGCAGGCTGCACCATATGTAGCTGCGTCGTCGCAGTACTACCAAGCCTATTTT

Full Affymetrix probeset data:

Annotations for 1634346_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720