Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634348_s_at:

>probe:Drosophila_2:1634348_s_at:2:703; Interrogation_Position=109; Antisense; TTATTCTGGATACAGCCTGCATCCG
>probe:Drosophila_2:1634348_s_at:169:47; Interrogation_Position=129; Antisense; ATCCGCACACCCAAATGGCAGATAC
>probe:Drosophila_2:1634348_s_at:613:427; Interrogation_Position=157; Antisense; GAGATTTAACCCTTCTGTATCGGCC
>probe:Drosophila_2:1634348_s_at:681:39; Interrogation_Position=175; Antisense; ATCGGCCTTGCAGTTGCTAGCTGAA
>probe:Drosophila_2:1634348_s_at:242:177; Interrogation_Position=210; Antisense; AAACGTATGGACTCGGCTACCACAT
>probe:Drosophila_2:1634348_s_at:261:467; Interrogation_Position=254; Antisense; GTTGACTATGAACACCCGGATCCGT
>probe:Drosophila_2:1634348_s_at:53:545; Interrogation_Position=271; Antisense; GGATCCGTCCAAGAACTAAGAGCTA
>probe:Drosophila_2:1634348_s_at:137:355; Interrogation_Position=313; Antisense; GCACCTGGCCAGAACACCTATTGGT
>probe:Drosophila_2:1634348_s_at:37:261; Interrogation_Position=327; Antisense; CACCTATTGGTACTCATCACGGAAC
>probe:Drosophila_2:1634348_s_at:524:3; Interrogation_Position=352; Antisense; ATTGAATCGTTGGAAGGCCGCACAA
>probe:Drosophila_2:1634348_s_at:618:75; Interrogation_Position=36; Antisense; AGGAGCAGCTTTCGATCGCGCCTTA
>probe:Drosophila_2:1634348_s_at:136:639; Interrogation_Position=431; Antisense; TCGGCCCTTTGGACAAAATTTACAT
>probe:Drosophila_2:1634348_s_at:623:449; Interrogation_Position=49; Antisense; GATCGCGCCTTAGGGTCAGTCAGAC
>probe:Drosophila_2:1634348_s_at:337:495; Interrogation_Position=67; Antisense; GTCAGACCAATCCAGCCATCAAAAA

Paste this into a BLAST search page for me
TTATTCTGGATACAGCCTGCATCCGATCCGCACACCCAAATGGCAGATACGAGATTTAACCCTTCTGTATCGGCCATCGGCCTTGCAGTTGCTAGCTGAAAAACGTATGGACTCGGCTACCACATGTTGACTATGAACACCCGGATCCGTGGATCCGTCCAAGAACTAAGAGCTAGCACCTGGCCAGAACACCTATTGGTCACCTATTGGTACTCATCACGGAACATTGAATCGTTGGAAGGCCGCACAAAGGAGCAGCTTTCGATCGCGCCTTATCGGCCCTTTGGACAAAATTTACATGATCGCGCCTTAGGGTCAGTCAGACGTCAGACCAATCCAGCCATCAAAAA

Full Affymetrix probeset data:

Annotations for 1634348_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime