Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634349_at:

>probe:Drosophila_2:1634349_at:611:399; Interrogation_Position=4883; Antisense; GACAGGATCTAATACTCACCAGTGG
>probe:Drosophila_2:1634349_at:103:57; Interrogation_Position=4909; Antisense; ATGAGTAATCATCGTCCTGTCCTGG
>probe:Drosophila_2:1634349_at:684:285; Interrogation_Position=4925; Antisense; CTGTCCTGGCCATCCATTATAGGGA
>probe:Drosophila_2:1634349_at:282:167; Interrogation_Position=4970; Antisense; AAATGCTTCAGCTGATCCAGGGCTC
>probe:Drosophila_2:1634349_at:275:559; Interrogation_Position=5017; Antisense; GGAAACCAACTTCTGGTCAGCTGTT
>probe:Drosophila_2:1634349_at:529:647; Interrogation_Position=5033; Antisense; TCAGCTGTTTGGGTTGTCGACACAT
>probe:Drosophila_2:1634349_at:322:661; Interrogation_Position=5067; Antisense; TAAACGGTACTCTCATTCCGCGGAA
>probe:Drosophila_2:1634349_at:467:133; Interrogation_Position=5084; Antisense; CCGCGGAAATTCTGTTTGAGCCCAT
>probe:Drosophila_2:1634349_at:178:115; Interrogation_Position=5111; Antisense; AGCAGTTGAGCTTCCAGGAGCGCAT
>probe:Drosophila_2:1634349_at:255:123; Interrogation_Position=5129; Antisense; AGCGCATTCAACAACTAACTCCATT
>probe:Drosophila_2:1634349_at:543:187; Interrogation_Position=5204; Antisense; AACACTTTTACCTCTTCAGCTATAA
>probe:Drosophila_2:1634349_at:668:465; Interrogation_Position=5240; Antisense; GTTGGCAACAGCGTACGTTTGGCAT
>probe:Drosophila_2:1634349_at:393:277; Interrogation_Position=5333; Antisense; CTATTCTGCTGCTCTGCGGAAAGAA
>probe:Drosophila_2:1634349_at:23:679; Interrogation_Position=5367; Antisense; TAGTCTAGTGAAAGCCCTACTGGGC

Paste this into a BLAST search page for me
GACAGGATCTAATACTCACCAGTGGATGAGTAATCATCGTCCTGTCCTGGCTGTCCTGGCCATCCATTATAGGGAAAATGCTTCAGCTGATCCAGGGCTCGGAAACCAACTTCTGGTCAGCTGTTTCAGCTGTTTGGGTTGTCGACACATTAAACGGTACTCTCATTCCGCGGAACCGCGGAAATTCTGTTTGAGCCCATAGCAGTTGAGCTTCCAGGAGCGCATAGCGCATTCAACAACTAACTCCATTAACACTTTTACCTCTTCAGCTATAAGTTGGCAACAGCGTACGTTTGGCATCTATTCTGCTGCTCTGCGGAAAGAATAGTCTAGTGAAAGCCCTACTGGGC

Full Affymetrix probeset data:

Annotations for 1634349_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime