FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634350_at:

>probe:Drosophila_2:1634350_at:397:711; Interrogation_Position=2061; Antisense; TTCAACCAGCGTTCCAATCTGAAGA
>probe:Drosophila_2:1634350_at:327:621; Interrogation_Position=2133; Antisense; TGCGGGAAAGTCTTCCGGCGGAACT
>probe:Drosophila_2:1634350_at:110:561; Interrogation_Position=2152; Antisense; GGAACTGCGACTTGCGACGTCACAG
>probe:Drosophila_2:1634350_at:10:611; Interrogation_Position=2179; Antisense; TGACGCATAACTTGTCCGCCGGAGT
>probe:Drosophila_2:1634350_at:271:657; Interrogation_Position=2227; Antisense; TAAGTGATCCATTTGGCTCCGGCTC
>probe:Drosophila_2:1634350_at:89:91; Interrogation_Position=2292; Antisense; AGTACTGCAGCATCCTCCAGAGATT
>probe:Drosophila_2:1634350_at:588:265; Interrogation_Position=2309; Antisense; CAGAGATTTGGTGGCCGTCAGCGAT
>probe:Drosophila_2:1634350_at:377:465; Interrogation_Position=2331; Antisense; GATTGATCTTCCTCAGCTGATTCCT
>probe:Drosophila_2:1634350_at:356:649; Interrogation_Position=2343; Antisense; TCAGCTGATTCCTCACTCTTTGATA
>probe:Drosophila_2:1634350_at:680:661; Interrogation_Position=2382; Antisense; TAAAATCTCAATTGCAGCTCTCATG
>probe:Drosophila_2:1634350_at:262:117; Interrogation_Position=2397; Antisense; AGCTCTCATGAATACGAATCCCTCC
>probe:Drosophila_2:1634350_at:7:235; Interrogation_Position=2413; Antisense; AATCCCTCCATTTCGTAATCGTAAT
>probe:Drosophila_2:1634350_at:19:315; Interrogation_Position=2478; Antisense; GCCTTAGCTACTTTGGTTTAAGCCT
>probe:Drosophila_2:1634350_at:610:519; Interrogation_Position=2576; Antisense; GTGGACTCTTAATGTACGATCGAAT

Paste this into a BLAST search page for me
TTCAACCAGCGTTCCAATCTGAAGATGCGGGAAAGTCTTCCGGCGGAACTGGAACTGCGACTTGCGACGTCACAGTGACGCATAACTTGTCCGCCGGAGTTAAGTGATCCATTTGGCTCCGGCTCAGTACTGCAGCATCCTCCAGAGATTCAGAGATTTGGTGGCCGTCAGCGATGATTGATCTTCCTCAGCTGATTCCTTCAGCTGATTCCTCACTCTTTGATATAAAATCTCAATTGCAGCTCTCATGAGCTCTCATGAATACGAATCCCTCCAATCCCTCCATTTCGTAATCGTAATGCCTTAGCTACTTTGGTTTAAGCCTGTGGACTCTTAATGTACGATCGAAT

Full Affymetrix probeset data:

Annotations for 1634350_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720