FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634351_at:

>probe:Drosophila_2:1634351_at:136:623; Interrogation_Position=1001; Antisense; TGCGTTACAATCTGGCCCAGCGCAT
>probe:Drosophila_2:1634351_at:448:123; Interrogation_Position=1019; Antisense; AGCGCATTCTGTCCGCCATGGAGTA
>probe:Drosophila_2:1634351_at:544:267; Interrogation_Position=1035; Antisense; CATGGAGTACCAGGGACTGTCCGCC
>probe:Drosophila_2:1634351_at:722:223; Interrogation_Position=1075; Antisense; AAGGAGTGCCGCGAGATGACCAAAC
>probe:Drosophila_2:1634351_at:95:145; Interrogation_Position=1136; Antisense; ACTCCGGTGACCTGGGCATCAGTTT
>probe:Drosophila_2:1634351_at:710:35; Interrogation_Position=1153; Antisense; ATCAGTTTCACGTCGCGTCGCATGG
>probe:Drosophila_2:1634351_at:24:545; Interrogation_Position=1183; Antisense; GGATATGTCCAGGATGGCACCATCT
>probe:Drosophila_2:1634351_at:711:567; Interrogation_Position=1198; Antisense; GGCACCATCTTTTACGGCATCGAGG
>probe:Drosophila_2:1634351_at:467:81; Interrogation_Position=1226; Antisense; AGGTGGTGCACCAGGAACCGTTCAC
>probe:Drosophila_2:1634351_at:90:465; Interrogation_Position=1245; Antisense; GTTCACACTTTCCACGTAACTAAAT
>probe:Drosophila_2:1634351_at:423:669; Interrogation_Position=1269; Antisense; TTCGGAGTACCTACCTATCCAAGGA
>probe:Drosophila_2:1634351_at:643:209; Interrogation_Position=1383; Antisense; AAGAAGCACACGCATTTGTTTTAAA
>probe:Drosophila_2:1634351_at:679:353; Interrogation_Position=941; Antisense; GCACCTATGCGGATAACTGCCGTGG
>probe:Drosophila_2:1634351_at:514:67; Interrogation_Position=986; Antisense; ATGGCGAGACCCTCATGCGTTACAA

Paste this into a BLAST search page for me
TGCGTTACAATCTGGCCCAGCGCATAGCGCATTCTGTCCGCCATGGAGTACATGGAGTACCAGGGACTGTCCGCCAAGGAGTGCCGCGAGATGACCAAACACTCCGGTGACCTGGGCATCAGTTTATCAGTTTCACGTCGCGTCGCATGGGGATATGTCCAGGATGGCACCATCTGGCACCATCTTTTACGGCATCGAGGAGGTGGTGCACCAGGAACCGTTCACGTTCACACTTTCCACGTAACTAAATTTCGGAGTACCTACCTATCCAAGGAAAGAAGCACACGCATTTGTTTTAAAGCACCTATGCGGATAACTGCCGTGGATGGCGAGACCCTCATGCGTTACAA

Full Affymetrix probeset data:

Annotations for 1634351_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720