Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634353_at:

>probe:Drosophila_2:1634353_at:297:443; Interrogation_Position=139; Antisense; GATGTCCAGCCCGATGGCTTTGTCA
>probe:Drosophila_2:1634353_at:363:573; Interrogation_Position=153; Antisense; TGGCTTTGTCAGCAAGTTGGTCCTC
>probe:Drosophila_2:1634353_at:696:215; Interrogation_Position=166; Antisense; AAGTTGGTCCTCGACGACGGATCTG
>probe:Drosophila_2:1634353_at:374:289; Interrogation_Position=204; Antisense; CGGAGACATCCACGGCAACATCGAC
>probe:Drosophila_2:1634353_at:708:215; Interrogation_Position=24; Antisense; AAGATTTCTAGTCCGACAATCCACC
>probe:Drosophila_2:1634353_at:233:517; Interrogation_Position=257; Antisense; GTGTCCATGTGCGAGTGAGCTACAA
>probe:Drosophila_2:1634353_at:180:263; Interrogation_Position=341; Antisense; CAGCTGCCATCCTGAAGGCTATCGC
>probe:Drosophila_2:1634353_at:55:633; Interrogation_Position=35; Antisense; TCCGACAATCCACCCAAATCAAAAT
>probe:Drosophila_2:1634353_at:180:71; Interrogation_Position=356; Antisense; AGGCTATCGCCTACATCGAGGCTAA
>probe:Drosophila_2:1634353_at:439:437; Interrogation_Position=373; Antisense; GAGGCTAACCCCAGCAAGAACTAAG
>probe:Drosophila_2:1634353_at:614:105; Interrogation_Position=389; Antisense; AGAACTAAGTGAACCCGCCGACTAG
>probe:Drosophila_2:1634353_at:74:381; Interrogation_Position=399; Antisense; GAACCCGCCGACTAGGAACATGAAA
>probe:Drosophila_2:1634353_at:502:397; Interrogation_Position=431; Antisense; GACAGCTAGGTTGAGTTTGGATAAT
>probe:Drosophila_2:1634353_at:11:593; Interrogation_Position=95; Antisense; TGGTGGCCGCCAACGCTAATGTGGA

Paste this into a BLAST search page for me
GATGTCCAGCCCGATGGCTTTGTCATGGCTTTGTCAGCAAGTTGGTCCTCAAGTTGGTCCTCGACGACGGATCTGCGGAGACATCCACGGCAACATCGACAAGATTTCTAGTCCGACAATCCACCGTGTCCATGTGCGAGTGAGCTACAACAGCTGCCATCCTGAAGGCTATCGCTCCGACAATCCACCCAAATCAAAATAGGCTATCGCCTACATCGAGGCTAAGAGGCTAACCCCAGCAAGAACTAAGAGAACTAAGTGAACCCGCCGACTAGGAACCCGCCGACTAGGAACATGAAAGACAGCTAGGTTGAGTTTGGATAATTGGTGGCCGCCAACGCTAATGTGGA

Full Affymetrix probeset data:

Annotations for 1634353_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime