FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634355_at:

>probe:Drosophila_2:1634355_at:535:261; Interrogation_Position=308; Antisense; CAGCTCACTGTTGTCAGGGTCTCAA
>probe:Drosophila_2:1634355_at:348:87; Interrogation_Position=337; Antisense; AGTCGCATGTCTGTTGTGGCCGGAA
>probe:Drosophila_2:1634355_at:568:665; Interrogation_Position=406; Antisense; TACAGCATCCATCCCAAGTATCAGG
>probe:Drosophila_2:1634355_at:238:195; Interrogation_Position=431; Antisense; AACTGGTTACCAGCGATCTTGCCGT
>probe:Drosophila_2:1634355_at:410:451; Interrogation_Position=460; Antisense; TCCATCAAACCTCCGCTGAAGTTAA
>probe:Drosophila_2:1634355_at:434:529; Interrogation_Position=544; Antisense; GGAGTTCCAGTAACCTTGACGGGAT
>probe:Drosophila_2:1634355_at:306:319; Interrogation_Position=588; Antisense; GCCCTTTCCCTTCTTGGATAATGTG
>probe:Drosophila_2:1634355_at:220:385; Interrogation_Position=612; Antisense; GAACTATCCCAATGTTCTTCAGCGC
>probe:Drosophila_2:1634355_at:426:471; Interrogation_Position=625; Antisense; GTTCTTCAGCGCATGAGTTACCACA
>probe:Drosophila_2:1634355_at:293:707; Interrogation_Position=642; Antisense; TTACCACACCATCTCGAACAGTGAG
>probe:Drosophila_2:1634355_at:588:37; Interrogation_Position=706; Antisense; ATCTGCGCCAGAGGACCTTTTAGGG
>probe:Drosophila_2:1634355_at:430:221; Interrogation_Position=791; Antisense; AAGTGGGCATAGTATCCTACGGGCT
>probe:Drosophila_2:1634355_at:32:597; Interrogation_Position=821; Antisense; TGTGTGGTCTATACATCTCTCCGGA
>probe:Drosophila_2:1634355_at:499:433; Interrogation_Position=857; Antisense; GAGTGTCTACCTTCAGTGACTGGAT

Paste this into a BLAST search page for me
CAGCTCACTGTTGTCAGGGTCTCAAAGTCGCATGTCTGTTGTGGCCGGAATACAGCATCCATCCCAAGTATCAGGAACTGGTTACCAGCGATCTTGCCGTTCCATCAAACCTCCGCTGAAGTTAAGGAGTTCCAGTAACCTTGACGGGATGCCCTTTCCCTTCTTGGATAATGTGGAACTATCCCAATGTTCTTCAGCGCGTTCTTCAGCGCATGAGTTACCACATTACCACACCATCTCGAACAGTGAGATCTGCGCCAGAGGACCTTTTAGGGAAGTGGGCATAGTATCCTACGGGCTTGTGTGGTCTATACATCTCTCCGGAGAGTGTCTACCTTCAGTGACTGGAT

Full Affymetrix probeset data:

Annotations for 1634355_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720