FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634365_at:

>probe:Drosophila_2:1634365_at:62:321; Interrogation_Position=1274; Antisense; GCCGCCGACAAAGCAGGAACTGTAT
>probe:Drosophila_2:1634365_at:635:601; Interrogation_Position=1294; Antisense; TGTATGCAGGATCACCCAAGCTACT
>probe:Drosophila_2:1634365_at:393:629; Interrogation_Position=1330; Antisense; TCCACAGTCCGTTGCCGATGACCAA
>probe:Drosophila_2:1634365_at:151:51; Interrogation_Position=1411; Antisense; ATGCGCTCTCGCTGGGCTATCAACA
>probe:Drosophila_2:1634365_at:90:571; Interrogation_Position=1425; Antisense; GGCTATCAACAATCCGGAGCGGGTT
>probe:Drosophila_2:1634365_at:568:529; Interrogation_Position=1445; Antisense; GGGTTCGGTGGTTGCTGCACTACCA
>probe:Drosophila_2:1634365_at:489:173; Interrogation_Position=1490; Antisense; AAAGCTGCGCAGCTCGCTAAAGAAG
>probe:Drosophila_2:1634365_at:612:519; Interrogation_Position=1531; Antisense; GTGGCAATGGGTCAACATCCTCGCA
>probe:Drosophila_2:1634365_at:672:289; Interrogation_Position=1585; Antisense; CGGACTCGTTGACCAGCGATGACAG
>probe:Drosophila_2:1634365_at:487:55; Interrogation_Position=1603; Antisense; ATGACAGCTCCTACTTGAGTGCCAA
>probe:Drosophila_2:1634365_at:547:273; Interrogation_Position=1616; Antisense; CTTGAGTGCCAAAGAGGGTTCCATT
>probe:Drosophila_2:1634365_at:42:153; Interrogation_Position=1651; Antisense; ACAGTCGGGTGCGTTTCAGTCCGGA
>probe:Drosophila_2:1634365_at:638:631; Interrogation_Position=1670; Antisense; TCCGGAGGCCTATCTGGATGCCAAT
>probe:Drosophila_2:1634365_at:136:159; Interrogation_Position=1772; Antisense; ACAACAGCAGAGACGCCAGCGACAG

Paste this into a BLAST search page for me
GCCGCCGACAAAGCAGGAACTGTATTGTATGCAGGATCACCCAAGCTACTTCCACAGTCCGTTGCCGATGACCAAATGCGCTCTCGCTGGGCTATCAACAGGCTATCAACAATCCGGAGCGGGTTGGGTTCGGTGGTTGCTGCACTACCAAAAGCTGCGCAGCTCGCTAAAGAAGGTGGCAATGGGTCAACATCCTCGCACGGACTCGTTGACCAGCGATGACAGATGACAGCTCCTACTTGAGTGCCAACTTGAGTGCCAAAGAGGGTTCCATTACAGTCGGGTGCGTTTCAGTCCGGATCCGGAGGCCTATCTGGATGCCAATACAACAGCAGAGACGCCAGCGACAG

Full Affymetrix probeset data:

Annotations for 1634365_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720