FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634366_at:

>probe:Drosophila_2:1634366_at:471:57; Interrogation_Position=13; Antisense; ATGTTCTCCAACAAGTGCGGAATAC
>probe:Drosophila_2:1634366_at:499:251; Interrogation_Position=130; Antisense; CAAGTGGCACCCTTGGTACGCCGTG
>probe:Drosophila_2:1634366_at:677:279; Interrogation_Position=155; Antisense; CTCGATCGCCTGAGGGAGGATCCGT
>probe:Drosophila_2:1634366_at:429:435; Interrogation_Position=170; Antisense; GAGGATCCGTGGTCGTAACCGCCAG
>probe:Drosophila_2:1634366_at:688:659; Interrogation_Position=185; Antisense; TAACCGCCAGCAAGGACAACCAAGT
>probe:Drosophila_2:1634366_at:287:501; Interrogation_Position=212; Antisense; GTCGGGAGGCTAGTGTTCAGTACAA
>probe:Drosophila_2:1634366_at:352:513; Interrogation_Position=224; Antisense; GTGTTCAGTACAACCACAATCTGTA
>probe:Drosophila_2:1634366_at:233:621; Interrogation_Position=28; Antisense; TGCGGAATACTGATCCTCGTGTCCT
>probe:Drosophila_2:1634366_at:157:135; Interrogation_Position=284; Antisense; ACGCCCAGGCCAGTCGGAATTTCGA
>probe:Drosophila_2:1634366_at:51:289; Interrogation_Position=316; Antisense; CGGAACAACTACGAAGGCGGCATTC
>probe:Drosophila_2:1634366_at:232:517; Interrogation_Position=46; Antisense; GTGTCCTGCTGTCTGGTGACAATAG
>probe:Drosophila_2:1634366_at:360:397; Interrogation_Position=63; Antisense; GACAATAGTGGCCTCCTATCGTCAA
>probe:Drosophila_2:1634366_at:439:41; Interrogation_Position=80; Antisense; ATCGTCAACCATATCCCGAGGAGTT
>probe:Drosophila_2:1634366_at:341:75; Interrogation_Position=98; Antisense; AGGAGTTCCAGACCAGTCCAGAGCA

Paste this into a BLAST search page for me
ATGTTCTCCAACAAGTGCGGAATACCAAGTGGCACCCTTGGTACGCCGTGCTCGATCGCCTGAGGGAGGATCCGTGAGGATCCGTGGTCGTAACCGCCAGTAACCGCCAGCAAGGACAACCAAGTGTCGGGAGGCTAGTGTTCAGTACAAGTGTTCAGTACAACCACAATCTGTATGCGGAATACTGATCCTCGTGTCCTACGCCCAGGCCAGTCGGAATTTCGACGGAACAACTACGAAGGCGGCATTCGTGTCCTGCTGTCTGGTGACAATAGGACAATAGTGGCCTCCTATCGTCAAATCGTCAACCATATCCCGAGGAGTTAGGAGTTCCAGACCAGTCCAGAGCA

Full Affymetrix probeset data:

Annotations for 1634366_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720