FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634371_at:

>probe:Drosophila_2:1634371_at:414:625; Interrogation_Position=413; Antisense; TGCCCACGCGATTGGTGAGCTTCAA
>probe:Drosophila_2:1634371_at:126:251; Interrogation_Position=435; Antisense; CAATCTGCTGGTCTTCTTTGAAGCT
>probe:Drosophila_2:1634371_at:468:337; Interrogation_Position=529; Antisense; GCTCGCCTCAGAAATGGACACGTTC
>probe:Drosophila_2:1634371_at:647:27; Interrogation_Position=582; Antisense; ATACGTAGAGTTCACCTGTCCATTT
>probe:Drosophila_2:1634371_at:164:399; Interrogation_Position=624; Antisense; GACTCAGTTCCGACAGGTTCAATTG
>probe:Drosophila_2:1634371_at:168:335; Interrogation_Position=696; Antisense; GCTGCTAGCGCAAGTCAAGGCCAAT
>probe:Drosophila_2:1634371_at:685:249; Interrogation_Position=711; Antisense; CAAGGCCAATCCAGCATATTTCCAG
>probe:Drosophila_2:1634371_at:729:21; Interrogation_Position=726; Antisense; ATATTTCCAGCTGGCCGTGCAGGAG
>probe:Drosophila_2:1634371_at:444:155; Interrogation_Position=758; Antisense; ACAGAGAAACGTCAGCGCGCTTGCA
>probe:Drosophila_2:1634371_at:622:343; Interrogation_Position=776; Antisense; GCTTGCAGCCTGGTCTCATCATTGA
>probe:Drosophila_2:1634371_at:63:35; Interrogation_Position=793; Antisense; ATCATTGACCTGGAGCTGGACGTGC
>probe:Drosophila_2:1634371_at:726:195; Interrogation_Position=854; Antisense; AACGGCTTGGACAGTTCTGGCTGTA
>probe:Drosophila_2:1634371_at:604:713; Interrogation_Position=889; Antisense; TTCTTCGGCATCTCGTTTTACATAA
>probe:Drosophila_2:1634371_at:443:337; Interrogation_Position=956; Antisense; GCTCCTGGGAGATCATACCGTGGAA

Paste this into a BLAST search page for me
TGCCCACGCGATTGGTGAGCTTCAACAATCTGCTGGTCTTCTTTGAAGCTGCTCGCCTCAGAAATGGACACGTTCATACGTAGAGTTCACCTGTCCATTTGACTCAGTTCCGACAGGTTCAATTGGCTGCTAGCGCAAGTCAAGGCCAATCAAGGCCAATCCAGCATATTTCCAGATATTTCCAGCTGGCCGTGCAGGAGACAGAGAAACGTCAGCGCGCTTGCAGCTTGCAGCCTGGTCTCATCATTGAATCATTGACCTGGAGCTGGACGTGCAACGGCTTGGACAGTTCTGGCTGTATTCTTCGGCATCTCGTTTTACATAAGCTCCTGGGAGATCATACCGTGGAA

Full Affymetrix probeset data:

Annotations for 1634371_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720