Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634372_at:

>probe:Drosophila_2:1634372_at:14:417; Interrogation_Position=163; Antisense; GAGCGTCCTATTGGGCAAGTTCACA
>probe:Drosophila_2:1634372_at:686:307; Interrogation_Position=206; Antisense; TCCTTTGCGGTTGCCCTGTGGGAAA
>probe:Drosophila_2:1634372_at:620:163; Interrogation_Position=228; Antisense; AAATATTGACTTTCGCCAGGGAGCA
>probe:Drosophila_2:1634372_at:206:111; Interrogation_Position=249; Antisense; AGCAGCCCTACGAGCATTTGTCGGA
>probe:Drosophila_2:1634372_at:401:513; Interrogation_Position=279; Antisense; GTGTAATTGAAAACATCGGCCTCAT
>probe:Drosophila_2:1634372_at:520:41; Interrogation_Position=293; Antisense; ATCGGCCTCATATATCGGGACTACA
>probe:Drosophila_2:1634372_at:598:383; Interrogation_Position=32; Antisense; GAACTGTGCGTCAAAGTCTGCTCCA
>probe:Drosophila_2:1634372_at:232:55; Interrogation_Position=324; Antisense; ATGAACTTTTGCCAATGCCTCCGAA
>probe:Drosophila_2:1634372_at:223:247; Interrogation_Position=347; Antisense; AATTGTCCGCGAGAGATTTACGATC
>probe:Drosophila_2:1634372_at:475:669; Interrogation_Position=365; Antisense; TACGATCTGATGTGCGAGTGCTGGC
>probe:Drosophila_2:1634372_at:378:429; Interrogation_Position=403; Antisense; GAGTCGACCCAGTTTCCGCGAGATA
>probe:Drosophila_2:1634372_at:79:475; Interrogation_Position=456; Antisense; GTTTTAAGCCACAGACCCATACACA
>probe:Drosophila_2:1634372_at:305:621; Interrogation_Position=50; Antisense; TGCTCCATCGGCACTGTGATAAACC
>probe:Drosophila_2:1634372_at:240:131; Interrogation_Position=84; Antisense; ACGCGTCGGACTACTGCCAATTGGA

Paste this into a BLAST search page for me
GAGCGTCCTATTGGGCAAGTTCACATCCTTTGCGGTTGCCCTGTGGGAAAAAATATTGACTTTCGCCAGGGAGCAAGCAGCCCTACGAGCATTTGTCGGAGTGTAATTGAAAACATCGGCCTCATATCGGCCTCATATATCGGGACTACAGAACTGTGCGTCAAAGTCTGCTCCAATGAACTTTTGCCAATGCCTCCGAAAATTGTCCGCGAGAGATTTACGATCTACGATCTGATGTGCGAGTGCTGGCGAGTCGACCCAGTTTCCGCGAGATAGTTTTAAGCCACAGACCCATACACATGCTCCATCGGCACTGTGATAAACCACGCGTCGGACTACTGCCAATTGGA

Full Affymetrix probeset data:

Annotations for 1634372_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime