FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634374_at:

>probe:Drosophila_2:1634374_at:207:199; Interrogation_Position=1755; Antisense; AACGATTCGTATCACTATGCTCGCC
>probe:Drosophila_2:1634374_at:8:683; Interrogation_Position=1770; Antisense; TATGCTCGCCGGCAATGGAATCTTG
>probe:Drosophila_2:1634374_at:377:35; Interrogation_Position=1789; Antisense; ATCTTGTGGACGACGATCTGCTGAA
>probe:Drosophila_2:1634374_at:607:217; Interrogation_Position=1818; Antisense; AAGTACCTCAACGAATTCGATCGAG
>probe:Drosophila_2:1634374_at:498:411; Interrogation_Position=1885; Antisense; GACCCGCTTGGGTCAGCTGGAAGCA
>probe:Drosophila_2:1634374_at:622:95; Interrogation_Position=1921; Antisense; AGATAATCGCTTTCGAGCGTGCCGG
>probe:Drosophila_2:1634374_at:38:503; Interrogation_Position=1939; Antisense; GTGCCGGCCTGGTGTTCGTTTTCAA
>probe:Drosophila_2:1634374_at:505:701; Interrogation_Position=1957; Antisense; TTTTCAACTTCCATCCACAGCAGAG
>probe:Drosophila_2:1634374_at:566:155; Interrogation_Position=1973; Antisense; ACAGCAGAGTTTCACCGGATACCGT
>probe:Drosophila_2:1634374_at:117:593; Interrogation_Position=1999; Antisense; TGGGCACCAACTGGGCGGGCACCTA
>probe:Drosophila_2:1634374_at:582:17; Interrogation_Position=2128; Antisense; ATTTCATTGAGGTCTACACACCATC
>probe:Drosophila_2:1634374_at:61:705; Interrogation_Position=2168; Antisense; TTATGCCCGCGTCAGTGACTAGCTA
>probe:Drosophila_2:1634374_at:155:105; Interrogation_Position=2196; Antisense; AGACGCAATTAACCGGATCTGACCG
>probe:Drosophila_2:1634374_at:686:473; Interrogation_Position=2280; Antisense; GTTACGAATCGGGATGCCATCATTA

Paste this into a BLAST search page for me
AACGATTCGTATCACTATGCTCGCCTATGCTCGCCGGCAATGGAATCTTGATCTTGTGGACGACGATCTGCTGAAAAGTACCTCAACGAATTCGATCGAGGACCCGCTTGGGTCAGCTGGAAGCAAGATAATCGCTTTCGAGCGTGCCGGGTGCCGGCCTGGTGTTCGTTTTCAATTTTCAACTTCCATCCACAGCAGAGACAGCAGAGTTTCACCGGATACCGTTGGGCACCAACTGGGCGGGCACCTAATTTCATTGAGGTCTACACACCATCTTATGCCCGCGTCAGTGACTAGCTAAGACGCAATTAACCGGATCTGACCGGTTACGAATCGGGATGCCATCATTA

Full Affymetrix probeset data:

Annotations for 1634374_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720