Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634377_at:

>probe:Drosophila_2:1634377_at:662:721; Interrogation_Position=1118; Antisense; TTGCCGCTCGCCAAAGTGACGTGGA
>probe:Drosophila_2:1634377_at:8:63; Interrogation_Position=1180; Antisense; ATGTGCCGAGCCAAGTTTTGTGTGC
>probe:Drosophila_2:1634377_at:25:477; Interrogation_Position=1194; Antisense; GTTTTGTGTGCTTGATGTCAGCTAC
>probe:Drosophila_2:1634377_at:369:61; Interrogation_Position=1208; Antisense; ATGTCAGCTACATCACAACCACAGT
>probe:Drosophila_2:1634377_at:339:203; Interrogation_Position=1224; Antisense; AACCACAGTCGATGCAACTAACAGT
>probe:Drosophila_2:1634377_at:640:89; Interrogation_Position=1246; Antisense; AGTACTCAGAGTCAAGGCACCGAAG
>probe:Drosophila_2:1634377_at:194:375; Interrogation_Position=1270; Antisense; GAAGATACTAATGACACCACGTGAT
>probe:Drosophila_2:1634377_at:382:399; Interrogation_Position=1282; Antisense; GACACCACGTGATTTATGACTGTTA
>probe:Drosophila_2:1634377_at:113:541; Interrogation_Position=1316; Antisense; GGACTCTTAAATCGAACCTGGTTCT
>probe:Drosophila_2:1634377_at:219:367; Interrogation_Position=1329; Antisense; GAACCTGGTTCTTTATTGGTCTTAT
>probe:Drosophila_2:1634377_at:70:397; Interrogation_Position=1535; Antisense; GAAATATGCCTTAATATGCTCTGCA
>probe:Drosophila_2:1634377_at:66:219; Interrogation_Position=1580; Antisense; AAGTCCACTATCTAAATGCGTTTTA
>probe:Drosophila_2:1634377_at:282:325; Interrogation_Position=1597; Antisense; GCGTTTTATTTTCTTTGTCCTCTCA
>probe:Drosophila_2:1634377_at:409:163; Interrogation_Position=1632; Antisense; AAAGGCGTCATGCTAATTTATATAC

Paste this into a BLAST search page for me
TTGCCGCTCGCCAAAGTGACGTGGAATGTGCCGAGCCAAGTTTTGTGTGCGTTTTGTGTGCTTGATGTCAGCTACATGTCAGCTACATCACAACCACAGTAACCACAGTCGATGCAACTAACAGTAGTACTCAGAGTCAAGGCACCGAAGGAAGATACTAATGACACCACGTGATGACACCACGTGATTTATGACTGTTAGGACTCTTAAATCGAACCTGGTTCTGAACCTGGTTCTTTATTGGTCTTATGAAATATGCCTTAATATGCTCTGCAAAGTCCACTATCTAAATGCGTTTTAGCGTTTTATTTTCTTTGTCCTCTCAAAAGGCGTCATGCTAATTTATATAC

Full Affymetrix probeset data:

Annotations for 1634377_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime