FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634382_at:

>probe:Drosophila_2:1634382_at:686:299; Interrogation_Position=1026; Antisense; CCCGGCCCACTGTATTAATGGCTAA
>probe:Drosophila_2:1634382_at:413:609; Interrogation_Position=1071; Antisense; TGAGCAACATCAGCACACCGAAATG
>probe:Drosophila_2:1634382_at:117:199; Interrogation_Position=576; Antisense; AACGATCTGCTCAGCGTGAATGCCA
>probe:Drosophila_2:1634382_at:553:507; Interrogation_Position=636; Antisense; GTGCGTAAGATCGTCAGAGGCTGCT
>probe:Drosophila_2:1634382_at:466:99; Interrogation_Position=651; Antisense; AGAGGCTGCTACTTCGGCGAGGTAA
>probe:Drosophila_2:1634382_at:331:575; Interrogation_Position=666; Antisense; GGCGAGGTAAATGCCACCGATGTGT
>probe:Drosophila_2:1634382_at:438:595; Interrogation_Position=688; Antisense; TGTGGTGCAAAATGGACCCCACCCT
>probe:Drosophila_2:1634382_at:276:283; Interrogation_Position=711; Antisense; CTGTCGGCGGTGCAGAACTCAAGTT
>probe:Drosophila_2:1634382_at:617:495; Interrogation_Position=736; Antisense; GTCATGTGTGCGACAGCGAGAACTA
>probe:Drosophila_2:1634382_at:323:185; Interrogation_Position=798; Antisense; AAAATCTTCGGCAGTCTGGTCTTGT
>probe:Drosophila_2:1634382_at:696:533; Interrogation_Position=815; Antisense; GGTCTTGTTTCTCTTGGCAACTCAA
>probe:Drosophila_2:1634382_at:204:567; Interrogation_Position=830; Antisense; GGCAACTCAACTACTCTGAGGCGAC
>probe:Drosophila_2:1634382_at:43:679; Interrogation_Position=938; Antisense; TAGATGTATTCCCAAGGCCCAGGAC
>probe:Drosophila_2:1634382_at:194:15; Interrogation_Position=983; Antisense; ATTAGTAGAGCACACCATCCACAAA

Paste this into a BLAST search page for me
CCCGGCCCACTGTATTAATGGCTAATGAGCAACATCAGCACACCGAAATGAACGATCTGCTCAGCGTGAATGCCAGTGCGTAAGATCGTCAGAGGCTGCTAGAGGCTGCTACTTCGGCGAGGTAAGGCGAGGTAAATGCCACCGATGTGTTGTGGTGCAAAATGGACCCCACCCTCTGTCGGCGGTGCAGAACTCAAGTTGTCATGTGTGCGACAGCGAGAACTAAAAATCTTCGGCAGTCTGGTCTTGTGGTCTTGTTTCTCTTGGCAACTCAAGGCAACTCAACTACTCTGAGGCGACTAGATGTATTCCCAAGGCCCAGGACATTAGTAGAGCACACCATCCACAAA

Full Affymetrix probeset data:

Annotations for 1634382_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720