FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634384_at:

>probe:Drosophila_2:1634384_at:27:67; Interrogation_Position=13; Antisense; ATGGAGCAACTACTTTCTCGTCGCC
>probe:Drosophila_2:1634384_at:516:283; Interrogation_Position=136; Antisense; CTGCTGATCTTAATGGTTCCGTCCA
>probe:Drosophila_2:1634384_at:323:383; Interrogation_Position=174; Antisense; GAACTCGTTGCGGTTCTACAAGCGC
>probe:Drosophila_2:1634384_at:700:181; Interrogation_Position=204; Antisense; AAAACCAGATCGTCGGGAGTTCCAG
>probe:Drosophila_2:1634384_at:179:429; Interrogation_Position=220; Antisense; GAGTTCCAGCGTATCAGCATTGGCA
>probe:Drosophila_2:1634384_at:43:117; Interrogation_Position=235; Antisense; AGCATTGGCATTGGCGTAGGATTCC
>probe:Drosophila_2:1634384_at:149:485; Interrogation_Position=250; Antisense; GTAGGATTCCTTATCATGGGCTTGA
>probe:Drosophila_2:1634384_at:15:269; Interrogation_Position=264; Antisense; CATGGGCTTGATTGGATTCGTCGTT
>probe:Drosophila_2:1634384_at:353:543; Interrogation_Position=277; Antisense; GGATTCGTCGTTAAGCTGATGCACA
>probe:Drosophila_2:1634384_at:103:121; Interrogation_Position=290; Antisense; AGCTGATGCACATACCCATAGTCAA
>probe:Drosophila_2:1634384_at:450:501; Interrogation_Position=32; Antisense; GTCGCCGCAGATACAGGGCCAAATG
>probe:Drosophila_2:1634384_at:89:435; Interrogation_Position=63; Antisense; GAGGAGTGTCCGCAAATTCTTACCC
>probe:Drosophila_2:1634384_at:256:13; Interrogation_Position=78; Antisense; ATTCTTACCCGATTTGAAGTGCAAG
>probe:Drosophila_2:1634384_at:678:85; Interrogation_Position=95; Antisense; AGTGCAAGTCTGTGGAACGCATTAA

Paste this into a BLAST search page for me
ATGGAGCAACTACTTTCTCGTCGCCCTGCTGATCTTAATGGTTCCGTCCAGAACTCGTTGCGGTTCTACAAGCGCAAAACCAGATCGTCGGGAGTTCCAGGAGTTCCAGCGTATCAGCATTGGCAAGCATTGGCATTGGCGTAGGATTCCGTAGGATTCCTTATCATGGGCTTGACATGGGCTTGATTGGATTCGTCGTTGGATTCGTCGTTAAGCTGATGCACAAGCTGATGCACATACCCATAGTCAAGTCGCCGCAGATACAGGGCCAAATGGAGGAGTGTCCGCAAATTCTTACCCATTCTTACCCGATTTGAAGTGCAAGAGTGCAAGTCTGTGGAACGCATTAA

Full Affymetrix probeset data:

Annotations for 1634384_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720