Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634385_at:

>probe:Drosophila_2:1634385_at:442:357; Interrogation_Position=1000; Antisense; GCACACTGTCGAGCTGCAGGAACAT
>probe:Drosophila_2:1634385_at:586:227; Interrogation_Position=1046; Antisense; AAGGCCAACATAGCCGCTGAACTGG
>probe:Drosophila_2:1634385_at:498:311; Interrogation_Position=1101; Antisense; GCCAGGCTTTGGAAATGGCCTCCGA
>probe:Drosophila_2:1634385_at:315:437; Interrogation_Position=1124; Antisense; GAGGAGATCTCCAAGGCCAACCAGA
>probe:Drosophila_2:1634385_at:183:335; Interrogation_Position=1171; Antisense; GCTGCTCAACCTCAAAAAGACCATT
>probe:Drosophila_2:1634385_at:186:173; Interrogation_Position=1186; Antisense; AAAGACCATTGCCTGGCGCACAGAG
>probe:Drosophila_2:1634385_at:283:225; Interrogation_Position=1244; Antisense; AAGGAGAGCCTACTATCCCTGCGGG
>probe:Drosophila_2:1634385_at:192:323; Interrogation_Position=1279; Antisense; GCGCGAGGCTCGAATAACTATTGAA
>probe:Drosophila_2:1634385_at:393:111; Interrogation_Position=1326; Antisense; AGCAACTGCAATCCATGCGTAACTT
>probe:Drosophila_2:1634385_at:199:49; Interrogation_Position=1340; Antisense; ATGCGTAACTTTGCCCAGGGACTGG
>probe:Drosophila_2:1634385_at:1:191; Interrogation_Position=1398; Antisense; AAGAACGGCTTGCAATACCCACGGG
>probe:Drosophila_2:1634385_at:362:615; Interrogation_Position=1458; Antisense; TGCATTTTTTCGTTTTTTGTACCAG
>probe:Drosophila_2:1634385_at:376:467; Interrogation_Position=1496; Antisense; GTTGTATTATTCAGCTCTAGTCATA
>probe:Drosophila_2:1634385_at:275:43; Interrogation_Position=983; Antisense; ATCGAGGACCTCAAGCAGCACACTG

Paste this into a BLAST search page for me
GCACACTGTCGAGCTGCAGGAACATAAGGCCAACATAGCCGCTGAACTGGGCCAGGCTTTGGAAATGGCCTCCGAGAGGAGATCTCCAAGGCCAACCAGAGCTGCTCAACCTCAAAAAGACCATTAAAGACCATTGCCTGGCGCACAGAGAAGGAGAGCCTACTATCCCTGCGGGGCGCGAGGCTCGAATAACTATTGAAAGCAACTGCAATCCATGCGTAACTTATGCGTAACTTTGCCCAGGGACTGGAAGAACGGCTTGCAATACCCACGGGTGCATTTTTTCGTTTTTTGTACCAGGTTGTATTATTCAGCTCTAGTCATAATCGAGGACCTCAAGCAGCACACTG

Full Affymetrix probeset data:

Annotations for 1634385_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime