Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634387_at:

>probe:Drosophila_2:1634387_at:52:521; Interrogation_Position=1180; Antisense; GTGGAGTGCGCTCTACATCATGATC
>probe:Drosophila_2:1634387_at:147:87; Interrogation_Position=1184; Antisense; AGTGCGCTCTACATCATGATCCGGA
>probe:Drosophila_2:1634387_at:624:323; Interrogation_Position=1187; Antisense; GCGCTCTACATCATGATCCGGATAG
>probe:Drosophila_2:1634387_at:602:271; Interrogation_Position=1195; Antisense; CATCATGATCCGGATAGCTACTTGA
>probe:Drosophila_2:1634387_at:525:449; Interrogation_Position=1201; Antisense; GATCCGGATAGCTACTTGAATAACA
>probe:Drosophila_2:1634387_at:412:673; Interrogation_Position=1209; Antisense; TAGCTACTTGAATAACATCACGGTA
>probe:Drosophila_2:1634387_at:562:141; Interrogation_Position=1223; Antisense; ACATCACGGTAGCTGGAATTGGTCT
>probe:Drosophila_2:1634387_at:529:365; Interrogation_Position=1296; Antisense; GAATCACATACTGAAGGTGTTCCTA
>probe:Drosophila_2:1634387_at:713:371; Interrogation_Position=1308; Antisense; GAAGGTGTTCCTATTCATCTGCATT
>probe:Drosophila_2:1634387_at:409:531; Interrogation_Position=1311; Antisense; GGTGTTCCTATTCATCTGCATTTTC
>probe:Drosophila_2:1634387_at:129:721; Interrogation_Position=1315; Antisense; TTCCTATTCATCTGCATTTTCCTGG
>probe:Drosophila_2:1634387_at:236:689; Interrogation_Position=1319; Antisense; TATTCATCTGCATTTTCCTGGTGGG
>probe:Drosophila_2:1634387_at:300:647; Interrogation_Position=1322; Antisense; TCATCTGCATTTTCCTGGTGGGCAG
>probe:Drosophila_2:1634387_at:141:343; Interrogation_Position=1328; Antisense; GCATTTTCCTGGTGGGCAGCCTGTA

Paste this into a BLAST search page for me
GTGGAGTGCGCTCTACATCATGATCAGTGCGCTCTACATCATGATCCGGAGCGCTCTACATCATGATCCGGATAGCATCATGATCCGGATAGCTACTTGAGATCCGGATAGCTACTTGAATAACATAGCTACTTGAATAACATCACGGTAACATCACGGTAGCTGGAATTGGTCTGAATCACATACTGAAGGTGTTCCTAGAAGGTGTTCCTATTCATCTGCATTGGTGTTCCTATTCATCTGCATTTTCTTCCTATTCATCTGCATTTTCCTGGTATTCATCTGCATTTTCCTGGTGGGTCATCTGCATTTTCCTGGTGGGCAGGCATTTTCCTGGTGGGCAGCCTGTA

Full Affymetrix probeset data:

Annotations for 1634387_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime