Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634388_at:

>probe:Drosophila_2:1634388_at:527:719; Interrogation_Position=115; Antisense; TTGCTGCGGGTGATTGTCCTTCATC
>probe:Drosophila_2:1634388_at:697:383; Interrogation_Position=152; Antisense; GAACTGTACGCCAAAATGCCTGCAT
>probe:Drosophila_2:1634388_at:502:167; Interrogation_Position=204; Antisense; AAATGCTGTCCGAATTTGTGCAACG
>probe:Drosophila_2:1634388_at:221:511; Interrogation_Position=221; Antisense; GTGCAACGGTCGCAGTTGTGCTCAA
>probe:Drosophila_2:1634388_at:403:727; Interrogation_Position=236; Antisense; TTGTGCTCAACCGAATGTCCTGGGA
>probe:Drosophila_2:1634388_at:691:383; Interrogation_Position=296; Antisense; GAACTCTGGAGCTACTGGCAGTTAT
>probe:Drosophila_2:1634388_at:698:287; Interrogation_Position=323; Antisense; CGGCAATGTCAAGTGCGGCAGCTTT
>probe:Drosophila_2:1634388_at:441:487; Interrogation_Position=37; Antisense; GTAGCGGACGTTCAACTATCATCAT
>probe:Drosophila_2:1634388_at:468:127; Interrogation_Position=372; Antisense; ACCAAGCGACCCAAGTGCGTGAGAT
>probe:Drosophila_2:1634388_at:690:557; Interrogation_Position=423; Antisense; GGACACGGCAGCAATATCACGTTAT
>probe:Drosophila_2:1634388_at:278:663; Interrogation_Position=467; Antisense; TAAATGCAAACTCTTTAGCCCGTAA
>probe:Drosophila_2:1634388_at:168:685; Interrogation_Position=53; Antisense; TATCATCATGGTTAAGCTCGGCTTT
>probe:Drosophila_2:1634388_at:503:281; Interrogation_Position=69; Antisense; CTCGGCTTTCTTTCACTGTTAATTG
>probe:Drosophila_2:1634388_at:297:653; Interrogation_Position=88; Antisense; TAATTGCTGCCTGTGTGGTTGCTGC

Paste this into a BLAST search page for me
TTGCTGCGGGTGATTGTCCTTCATCGAACTGTACGCCAAAATGCCTGCATAAATGCTGTCCGAATTTGTGCAACGGTGCAACGGTCGCAGTTGTGCTCAATTGTGCTCAACCGAATGTCCTGGGAGAACTCTGGAGCTACTGGCAGTTATCGGCAATGTCAAGTGCGGCAGCTTTGTAGCGGACGTTCAACTATCATCATACCAAGCGACCCAAGTGCGTGAGATGGACACGGCAGCAATATCACGTTATTAAATGCAAACTCTTTAGCCCGTAATATCATCATGGTTAAGCTCGGCTTTCTCGGCTTTCTTTCACTGTTAATTGTAATTGCTGCCTGTGTGGTTGCTGC

Full Affymetrix probeset data:

Annotations for 1634388_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime