Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634390_s_at:

>probe:Drosophila_2:1634390_s_at:36:265; Interrogation_Position=345; Antisense; CAGATCCAGGGCGTCAACCGGGTGA
>probe:Drosophila_2:1634390_s_at:307:385; Interrogation_Position=386; Antisense; GAACATCCTGTTCGTGATCAACAAC
>probe:Drosophila_2:1634390_s_at:636:279; Interrogation_Position=443; Antisense; CTACATCGTGTTCGGTGAGGCCAAG
>probe:Drosophila_2:1634390_s_at:285:77; Interrogation_Position=472; Antisense; AGGATCTGTCGCAACAGGCCCAGGT
>probe:Drosophila_2:1634390_s_at:60:295; Interrogation_Position=506; Antisense; CGAGAAGTTCAAGGCCCCGGAGGCT
>probe:Drosophila_2:1634390_s_at:427:23; Interrogation_Position=628; Antisense; ATATCGAGCTGGTCATCACGCAGGC
>probe:Drosophila_2:1634390_s_at:291:523; Interrogation_Position=664; Antisense; GGGCCAAGGCGATCAAGGCTCTGAA
>probe:Drosophila_2:1634390_s_at:62:233; Interrogation_Position=699; Antisense; AATGACATCGTCAACGCCATCATGG
>probe:Drosophila_2:1634390_s_at:287:201; Interrogation_Position=711; Antisense; AACGCCATCATGGAGCTTACTATGC
>probe:Drosophila_2:1634390_s_at:635:695; Interrogation_Position=736; Antisense; TTTAGAGCGGGCTTCAGCGTTAGCT
>probe:Drosophila_2:1634390_s_at:664:353; Interrogation_Position=761; Antisense; GCACTCCTGATTTTGTTGTTTACCC
>probe:Drosophila_2:1634390_s_at:192:699; Interrogation_Position=779; Antisense; TTTACCCGCCTTTCGATAATACTGA
>probe:Drosophila_2:1634390_s_at:643:141; Interrogation_Position=799; Antisense; ACTGACCCAAATGTTGTGCATGCCC
>probe:Drosophila_2:1634390_s_at:8:527; Interrogation_Position=830; Antisense; GGGCAGCATGTTACACCAGTCGAAC

Paste this into a BLAST search page for me
CAGATCCAGGGCGTCAACCGGGTGAGAACATCCTGTTCGTGATCAACAACCTACATCGTGTTCGGTGAGGCCAAGAGGATCTGTCGCAACAGGCCCAGGTCGAGAAGTTCAAGGCCCCGGAGGCTATATCGAGCTGGTCATCACGCAGGCGGGCCAAGGCGATCAAGGCTCTGAAAATGACATCGTCAACGCCATCATGGAACGCCATCATGGAGCTTACTATGCTTTAGAGCGGGCTTCAGCGTTAGCTGCACTCCTGATTTTGTTGTTTACCCTTTACCCGCCTTTCGATAATACTGAACTGACCCAAATGTTGTGCATGCCCGGGCAGCATGTTACACCAGTCGAAC

Full Affymetrix probeset data:

Annotations for 1634390_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime