Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634391_at:

>probe:Drosophila_2:1634391_at:220:697; Interrogation_Position=5220; Antisense; TTTCTCCAAGCTTACAAACGCCTGT
>probe:Drosophila_2:1634391_at:98:315; Interrogation_Position=5239; Antisense; GCCTGTTTGCGCCTAATGAATGTTC
>probe:Drosophila_2:1634391_at:26:677; Interrogation_Position=5291; Antisense; TAGAGCCTGCATTTGCAAGACTTTT
>probe:Drosophila_2:1634391_at:256:251; Interrogation_Position=5306; Antisense; CAAGACTTTTGTGGTACTGCAGGAA
>probe:Drosophila_2:1634391_at:688:71; Interrogation_Position=5326; Antisense; AGGAATGCAATTACCGTCGACGAAT
>probe:Drosophila_2:1634391_at:16:501; Interrogation_Position=5341; Antisense; GTCGACGAATTACTGGTTGCCAATA
>probe:Drosophila_2:1634391_at:298:173; Interrogation_Position=5378; Antisense; AAACCATCATATTGGGATCCCTGCA
>probe:Drosophila_2:1634391_at:77:587; Interrogation_Position=5426; Antisense; TGGAGCGACTTTATGATCTCATACT
>probe:Drosophila_2:1634391_at:256:171; Interrogation_Position=5537; Antisense; AAAGCATTTTTTCCACCTATTACAG
>probe:Drosophila_2:1634391_at:161:233; Interrogation_Position=5568; Antisense; AATGCTGCAGTTTCGTTGGACCTGT
>probe:Drosophila_2:1634391_at:435:555; Interrogation_Position=5585; Antisense; GGACCTGTCAAAATTACTCGGATGT
>probe:Drosophila_2:1634391_at:698:115; Interrogation_Position=5650; Antisense; AGCTTTCTATTATGTCTTCATCTAG
>probe:Drosophila_2:1634391_at:589:37; Interrogation_Position=5669; Antisense; ATCTAGCTGATGACGACTCTTTAAG
>probe:Drosophila_2:1634391_at:596:465; Interrogation_Position=5708; Antisense; GATTGGATCCCGAGCACTATTATAT

Paste this into a BLAST search page for me
TTTCTCCAAGCTTACAAACGCCTGTGCCTGTTTGCGCCTAATGAATGTTCTAGAGCCTGCATTTGCAAGACTTTTCAAGACTTTTGTGGTACTGCAGGAAAGGAATGCAATTACCGTCGACGAATGTCGACGAATTACTGGTTGCCAATAAAACCATCATATTGGGATCCCTGCATGGAGCGACTTTATGATCTCATACTAAAGCATTTTTTCCACCTATTACAGAATGCTGCAGTTTCGTTGGACCTGTGGACCTGTCAAAATTACTCGGATGTAGCTTTCTATTATGTCTTCATCTAGATCTAGCTGATGACGACTCTTTAAGGATTGGATCCCGAGCACTATTATAT

Full Affymetrix probeset data:

Annotations for 1634391_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime