Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634392_at:

>probe:Drosophila_2:1634392_at:683:477; Interrogation_Position=1216; Antisense; GTTTATAACAGCTATGGCATACCGC
>probe:Drosophila_2:1634392_at:354:727; Interrogation_Position=1261; Antisense; TTGGAGTCCCTGTCGCACACAGAGT
>probe:Drosophila_2:1634392_at:426:101; Interrogation_Position=1281; Antisense; AGAGTCCATAACAGCTGCCTATAAT
>probe:Drosophila_2:1634392_at:267:365; Interrogation_Position=1317; Antisense; GAATCCGGCGGATGTATACCACCAG
>probe:Drosophila_2:1634392_at:585:231; Interrogation_Position=1390; Antisense; AATGAGGGCTACGATTACTCGCCAC
>probe:Drosophila_2:1634392_at:278:339; Interrogation_Position=1491; Antisense; GCTCAAGGATCTGACGCCCATTATA
>probe:Drosophila_2:1634392_at:275:15; Interrogation_Position=1510; Antisense; ATTATAGCCGCCTTGGAGGTGGCCA
>probe:Drosophila_2:1634392_at:320:377; Interrogation_Position=1581; Antisense; GAAGCAGGTGCACAAGCAGTCGCCC
>probe:Drosophila_2:1634392_at:367:609; Interrogation_Position=1619; Antisense; TGCCGCCGGTGGTGCAAAAGTCCAA
>probe:Drosophila_2:1634392_at:729:217; Interrogation_Position=1642; Antisense; AAGTACGTGTACAGTGCACCACCGC
>probe:Drosophila_2:1634392_at:127:127; Interrogation_Position=1673; Antisense; ACCAAGGACACAGCGGTGGCTACAA
>probe:Drosophila_2:1634392_at:420:275; Interrogation_Position=1740; Antisense; CTTCCGGCCGCAGGATTACGAGATA
>probe:Drosophila_2:1634392_at:532:77; Interrogation_Position=1766; Antisense; AGGATCCACTGATGTTCAACCGCCT
>probe:Drosophila_2:1634392_at:83:473; Interrogation_Position=1779; Antisense; GTTCAACCGCCTGCTGGAGGTCTAA

Paste this into a BLAST search page for me
GTTTATAACAGCTATGGCATACCGCTTGGAGTCCCTGTCGCACACAGAGTAGAGTCCATAACAGCTGCCTATAATGAATCCGGCGGATGTATACCACCAGAATGAGGGCTACGATTACTCGCCACGCTCAAGGATCTGACGCCCATTATAATTATAGCCGCCTTGGAGGTGGCCAGAAGCAGGTGCACAAGCAGTCGCCCTGCCGCCGGTGGTGCAAAAGTCCAAAAGTACGTGTACAGTGCACCACCGCACCAAGGACACAGCGGTGGCTACAACTTCCGGCCGCAGGATTACGAGATAAGGATCCACTGATGTTCAACCGCCTGTTCAACCGCCTGCTGGAGGTCTAA

Full Affymetrix probeset data:

Annotations for 1634392_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime