Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634394_at:

>probe:Drosophila_2:1634394_at:244:55; Interrogation_Position=1082; Antisense; ATGAAGTTGTACTCACTGCAGCCGA
>probe:Drosophila_2:1634394_at:376:69; Interrogation_Position=1108; Antisense; ATGGCGCCTTTGTCGATGAACACAG
>probe:Drosophila_2:1634394_at:309:387; Interrogation_Position=1125; Antisense; GAACACAGCTTTGCAATTGACGAAA
>probe:Drosophila_2:1634394_at:495:669; Interrogation_Position=637; Antisense; TACCTATTTCTTTTCGTTACCCATG
>probe:Drosophila_2:1634394_at:662:291; Interrogation_Position=651; Antisense; CGTTACCCATGTGCCGTTAATCAAG
>probe:Drosophila_2:1634394_at:571:219; Interrogation_Position=740; Antisense; AAGTGAGAGCCATGCTTTGCGACCT
>probe:Drosophila_2:1634394_at:403:467; Interrogation_Position=765; Antisense; GTTGGTCTGGCATCAGCTGTATACT
>probe:Drosophila_2:1634394_at:118:645; Interrogation_Position=815; Antisense; TCTATTCCATAGTCTTGTTCGTTCA
>probe:Drosophila_2:1634394_at:216:599; Interrogation_Position=830; Antisense; TGTTCGTTCAACTTTCCACAACTTG
>probe:Drosophila_2:1634394_at:616:159; Interrogation_Position=847; Antisense; ACAACTTGCGTAGGTCTTCTCTGTA
>probe:Drosophila_2:1634394_at:519:715; Interrogation_Position=863; Antisense; TTCTCTGTACCATATCTTGCATCTT
>probe:Drosophila_2:1634394_at:626:641; Interrogation_Position=912; Antisense; TCTTTACCTTTTATATGCCGCCATA
>probe:Drosophila_2:1634394_at:542:29; Interrogation_Position=934; Antisense; ATAACTCTCTACACCTTTTGCGGCT
>probe:Drosophila_2:1634394_at:504:693; Interrogation_Position=950; Antisense; TTTGCGGCTTGGGTACTTTAGTAGA

Paste this into a BLAST search page for me
ATGAAGTTGTACTCACTGCAGCCGAATGGCGCCTTTGTCGATGAACACAGGAACACAGCTTTGCAATTGACGAAATACCTATTTCTTTTCGTTACCCATGCGTTACCCATGTGCCGTTAATCAAGAAGTGAGAGCCATGCTTTGCGACCTGTTGGTCTGGCATCAGCTGTATACTTCTATTCCATAGTCTTGTTCGTTCATGTTCGTTCAACTTTCCACAACTTGACAACTTGCGTAGGTCTTCTCTGTATTCTCTGTACCATATCTTGCATCTTTCTTTACCTTTTATATGCCGCCATAATAACTCTCTACACCTTTTGCGGCTTTTGCGGCTTGGGTACTTTAGTAGA

Full Affymetrix probeset data:

Annotations for 1634394_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime