FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634396_at:

>probe:Drosophila_2:1634396_at:401:627; Interrogation_Position=1039; Antisense; TGCCACATCCAGTTGGGTCATGCCT
>probe:Drosophila_2:1634396_at:90:139; Interrogation_Position=1069; Antisense; ACGATTGTCTCCCACGAATGGAAAT
>probe:Drosophila_2:1634396_at:200:395; Interrogation_Position=1089; Antisense; GAAATGGAACGGTATGCGCCTGATA
>probe:Drosophila_2:1634396_at:203:25; Interrogation_Position=1111; Antisense; ATAGGAACCGTCTATCCGGACAGCT
>probe:Drosophila_2:1634396_at:65:39; Interrogation_Position=1157; Antisense; ATCTCGCAACCTCAGTCAAATTACT
>probe:Drosophila_2:1634396_at:124:669; Interrogation_Position=1178; Antisense; TACTGACATTCGATTCGGTCGCACT
>probe:Drosophila_2:1634396_at:698:533; Interrogation_Position=1194; Antisense; GGTCGCACTGTTACCTCATCGAAAT
>probe:Drosophila_2:1634396_at:463:225; Interrogation_Position=1225; Antisense; AAGGCTAACCTCCAAGCTCAAAGTC
>probe:Drosophila_2:1634396_at:161:149; Interrogation_Position=1269; Antisense; ACTTTATGAGTGCTTGGCCCAGTTG
>probe:Drosophila_2:1634396_at:445:73; Interrogation_Position=1322; Antisense; AGGACATGAACAATGCCCATCTGCC
>probe:Drosophila_2:1634396_at:719:601; Interrogation_Position=1359; Antisense; TGTTTTGACAGGATTGCGTGGCGCA
>probe:Drosophila_2:1634396_at:614:521; Interrogation_Position=1376; Antisense; GTGGCGCAGAGCACTTACATCACGA
>probe:Drosophila_2:1634396_at:597:705; Interrogation_Position=1514; Antisense; TTATGCAGTCATTAAGCTCACCCTC
>probe:Drosophila_2:1634396_at:332:117; Interrogation_Position=1528; Antisense; AGCTCACCCTCGAAATGGATTCTAC

Paste this into a BLAST search page for me
TGCCACATCCAGTTGGGTCATGCCTACGATTGTCTCCCACGAATGGAAATGAAATGGAACGGTATGCGCCTGATAATAGGAACCGTCTATCCGGACAGCTATCTCGCAACCTCAGTCAAATTACTTACTGACATTCGATTCGGTCGCACTGGTCGCACTGTTACCTCATCGAAATAAGGCTAACCTCCAAGCTCAAAGTCACTTTATGAGTGCTTGGCCCAGTTGAGGACATGAACAATGCCCATCTGCCTGTTTTGACAGGATTGCGTGGCGCAGTGGCGCAGAGCACTTACATCACGATTATGCAGTCATTAAGCTCACCCTCAGCTCACCCTCGAAATGGATTCTAC

Full Affymetrix probeset data:

Annotations for 1634396_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720