FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634399_at:

>probe:Drosophila_2:1634399_at:353:349; Interrogation_Position=108; Antisense; GCAGTTCAGCATTTACCAAACGCCG
>probe:Drosophila_2:1634399_at:217:177; Interrogation_Position=125; Antisense; AAACGCCGCCGACGAATGTCATCAA
>probe:Drosophila_2:1634399_at:323:369; Interrogation_Position=138; Antisense; GAATGTCATCAAGTCATGGCTGAGA
>probe:Drosophila_2:1634399_at:169:219; Interrogation_Position=148; Antisense; AAGTCATGGCTGAGACACTTCGAGA
>probe:Drosophila_2:1634399_at:276:105; Interrogation_Position=160; Antisense; AGACACTTCGAGAGCACAGGATCCT
>probe:Drosophila_2:1634399_at:663:425; Interrogation_Position=169; Antisense; GAGAGCACAGGATCCTCGCAAGGAG
>probe:Drosophila_2:1634399_at:558:549; Interrogation_Position=199; Antisense; GGAGGATATGCACGATCCTCGCTGC
>probe:Drosophila_2:1634399_at:496:335; Interrogation_Position=219; Antisense; GCTGCCTCAAATCTTCTGTACCATT
>probe:Drosophila_2:1634399_at:321:129; Interrogation_Position=238; Antisense; ACCATTTGCAATCAGTGCCTGAGTA
>probe:Drosophila_2:1634399_at:417:653; Interrogation_Position=261; Antisense; TAATGAGAAGAACTTTAGCAGCTCC
>probe:Drosophila_2:1634399_at:60:597; Interrogation_Position=30; Antisense; TGTGCACCGGGCGTTCGTCATACGC
>probe:Drosophila_2:1634399_at:224:497; Interrogation_Position=46; Antisense; GTCATACGCGCCTACTACAAGAGCA
>probe:Drosophila_2:1634399_at:543:213; Interrogation_Position=64; Antisense; AAGAGCAATGACTCCATCAGCACCG
>probe:Drosophila_2:1634399_at:161:321; Interrogation_Position=88; Antisense; GCCCAGCGGCTCTTCAAGAAGCAGT

Paste this into a BLAST search page for me
GCAGTTCAGCATTTACCAAACGCCGAAACGCCGCCGACGAATGTCATCAAGAATGTCATCAAGTCATGGCTGAGAAAGTCATGGCTGAGACACTTCGAGAAGACACTTCGAGAGCACAGGATCCTGAGAGCACAGGATCCTCGCAAGGAGGGAGGATATGCACGATCCTCGCTGCGCTGCCTCAAATCTTCTGTACCATTACCATTTGCAATCAGTGCCTGAGTATAATGAGAAGAACTTTAGCAGCTCCTGTGCACCGGGCGTTCGTCATACGCGTCATACGCGCCTACTACAAGAGCAAAGAGCAATGACTCCATCAGCACCGGCCCAGCGGCTCTTCAAGAAGCAGT

Full Affymetrix probeset data:

Annotations for 1634399_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720