FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634402_at:

>probe:Drosophila_2:1634402_at:248:215; Interrogation_Position=1035; Antisense; AAGATTTGCGTGTGCATGCCGCATG
>probe:Drosophila_2:1634402_at:43:491; Interrogation_Position=1089; Antisense; GTACACAACGGACCCAAGATCACAT
>probe:Drosophila_2:1634402_at:281:121; Interrogation_Position=1125; Antisense; AGCGGCAAGGACGATCCCTGCGAGA
>probe:Drosophila_2:1634402_at:681:631; Interrogation_Position=1139; Antisense; TCCCTGCGAGATCAACTAAGTGCGT
>probe:Drosophila_2:1634402_at:347:229; Interrogation_Position=609; Antisense; AATGGAGCAGCCAGCGAACGCGATA
>probe:Drosophila_2:1634402_at:23:383; Interrogation_Position=624; Antisense; GAACGCGATAGGATCGTCCTGAACA
>probe:Drosophila_2:1634402_at:392:81; Interrogation_Position=652; Antisense; AGGGTATCCTCGTGCAGGCCACGAA
>probe:Drosophila_2:1634402_at:156:601; Interrogation_Position=679; Antisense; TGTTCGAGGTCAAGGACCCCGTCGA
>probe:Drosophila_2:1634402_at:542:39; Interrogation_Position=727; Antisense; ATCGTCCGCAGTATAACATTCCGGG
>probe:Drosophila_2:1634402_at:337:257; Interrogation_Position=773; Antisense; CAAAGTGGTTAGTGCCAGCGGCATC
>probe:Drosophila_2:1634402_at:165:669; Interrogation_Position=870; Antisense; TACTTCGACGGAGCCAGCGTTGACA
>probe:Drosophila_2:1634402_at:14:123; Interrogation_Position=885; Antisense; AGCGTTGACATGCAGGCCGAGCACC
>probe:Drosophila_2:1634402_at:175:287; Interrogation_Position=945; Antisense; CTGGAGGCAGGCACGGGTATCTTTC
>probe:Drosophila_2:1634402_at:677:481; Interrogation_Position=961; Antisense; GTATCTTTCTGGACATGGACCGCAT

Paste this into a BLAST search page for me
AAGATTTGCGTGTGCATGCCGCATGGTACACAACGGACCCAAGATCACATAGCGGCAAGGACGATCCCTGCGAGATCCCTGCGAGATCAACTAAGTGCGTAATGGAGCAGCCAGCGAACGCGATAGAACGCGATAGGATCGTCCTGAACAAGGGTATCCTCGTGCAGGCCACGAATGTTCGAGGTCAAGGACCCCGTCGAATCGTCCGCAGTATAACATTCCGGGCAAAGTGGTTAGTGCCAGCGGCATCTACTTCGACGGAGCCAGCGTTGACAAGCGTTGACATGCAGGCCGAGCACCCTGGAGGCAGGCACGGGTATCTTTCGTATCTTTCTGGACATGGACCGCAT

Full Affymetrix probeset data:

Annotations for 1634402_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720