Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634404_at:

>probe:Drosophila_2:1634404_at:442:465; Interrogation_Position=1104; Antisense; GATTGTGCAGCGTTTGTCTGGGAAT
>probe:Drosophila_2:1634404_at:194:613; Interrogation_Position=1169; Antisense; TGAAAGAAGCCTATCCGCAACACTC
>probe:Drosophila_2:1634404_at:224:359; Interrogation_Position=1185; Antisense; GCAACACTCCAACTTAGATCTAGCC
>probe:Drosophila_2:1634404_at:168:453; Interrogation_Position=1201; Antisense; GATCTAGCCGAGGAGCACATATTGG
>probe:Drosophila_2:1634404_at:173:509; Interrogation_Position=1228; Antisense; GTGCTGAATTGGTCATCAAAGCGCT
>probe:Drosophila_2:1634404_at:16:175; Interrogation_Position=1245; Antisense; AAAGCGCTTAACACTGCTCCAAGAT
>probe:Drosophila_2:1634404_at:197:357; Interrogation_Position=1280; Antisense; GCAAACTGAGTTTCCTGTGGGTGAA
>probe:Drosophila_2:1634404_at:579:517; Interrogation_Position=1296; Antisense; GTGGGTGAAACCCAGCGATTTTCAA
>probe:Drosophila_2:1634404_at:575:359; Interrogation_Position=1341; Antisense; GCAACTAGCTCACTTGCTGCAGTTA
>probe:Drosophila_2:1634404_at:118:475; Interrogation_Position=1362; Antisense; GTTAATCAACGCTATCCAGGACTTT
>probe:Drosophila_2:1634404_at:122:659; Interrogation_Position=1466; Antisense; TAAGAGCAGCCCTAAGTGGCCTAAA
>probe:Drosophila_2:1634404_at:104:551; Interrogation_Position=1518; Antisense; GGAGATCCTAGGCAAATCCGTCACT
>probe:Drosophila_2:1634404_at:194:199; Interrogation_Position=1547; Antisense; AACGACTCAAAGAAGCTCTGCCCAA
>probe:Drosophila_2:1634404_at:115:337; Interrogation_Position=1561; Antisense; GCTCTGCCCAAGGAAAGTCTGCATT

Paste this into a BLAST search page for me
GATTGTGCAGCGTTTGTCTGGGAATTGAAAGAAGCCTATCCGCAACACTCGCAACACTCCAACTTAGATCTAGCCGATCTAGCCGAGGAGCACATATTGGGTGCTGAATTGGTCATCAAAGCGCTAAAGCGCTTAACACTGCTCCAAGATGCAAACTGAGTTTCCTGTGGGTGAAGTGGGTGAAACCCAGCGATTTTCAAGCAACTAGCTCACTTGCTGCAGTTAGTTAATCAACGCTATCCAGGACTTTTAAGAGCAGCCCTAAGTGGCCTAAAGGAGATCCTAGGCAAATCCGTCACTAACGACTCAAAGAAGCTCTGCCCAAGCTCTGCCCAAGGAAAGTCTGCATT

Full Affymetrix probeset data:

Annotations for 1634404_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime