Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634406_at:

>probe:Drosophila_2:1634406_at:331:593; Interrogation_Position=1871; Antisense; TGTGGTAAACATACCCAAAGCCCCA
>probe:Drosophila_2:1634406_at:419:611; Interrogation_Position=1876; Antisense; TAAACATACCCAAAGCCCCAAATTG
>probe:Drosophila_2:1634406_at:320:667; Interrogation_Position=1882; Antisense; TACCCAAAGCCCCAAATTGTGCATG
>probe:Drosophila_2:1634406_at:150:175; Interrogation_Position=1887; Antisense; AAAGCCCCAAATTGTGCATGTTACA
>probe:Drosophila_2:1634406_at:395:509; Interrogation_Position=1900; Antisense; GTGCATGTTACACAAAGTGTCCAGC
>probe:Drosophila_2:1634406_at:190:665; Interrogation_Position=1908; Antisense; TACACAAAGTGTCCAGCCGACTGGC
>probe:Drosophila_2:1634406_at:632:295; Interrogation_Position=1925; Antisense; CGACTGGCCCCATAGTGCATGAGAA
>probe:Drosophila_2:1634406_at:266:287; Interrogation_Position=1928; Antisense; CTGGCCCCATAGTGCATGAGAAGAT
>probe:Drosophila_2:1634406_at:329:307; Interrogation_Position=1934; Antisense; CCATAGTGCATGAGAAGATCGTGAT
>probe:Drosophila_2:1634406_at:636:97; Interrogation_Position=1949; Antisense; AGATCGTGATGTTGAATGGACCAAA
>probe:Drosophila_2:1634406_at:47:679; Interrogation_Position=1979; Antisense; TAGATAAAGCGATCCTTTCCCCAAC
>probe:Drosophila_2:1634406_at:434:45; Interrogation_Position=1990; Antisense; ATCCTTTCCCCAACTTGTAGAGCGG
>probe:Drosophila_2:1634406_at:303:717; Interrogation_Position=1995; Antisense; TTCCCCAACTTGTAGAGCGGGCCTA
>probe:Drosophila_2:1634406_at:218:277; Interrogation_Position=1998; Antisense; CCCAACTTGTAGAGCGGGCCTATTC

Paste this into a BLAST search page for me
TGTGGTAAACATACCCAAAGCCCCATAAACATACCCAAAGCCCCAAATTGTACCCAAAGCCCCAAATTGTGCATGAAAGCCCCAAATTGTGCATGTTACAGTGCATGTTACACAAAGTGTCCAGCTACACAAAGTGTCCAGCCGACTGGCCGACTGGCCCCATAGTGCATGAGAACTGGCCCCATAGTGCATGAGAAGATCCATAGTGCATGAGAAGATCGTGATAGATCGTGATGTTGAATGGACCAAATAGATAAAGCGATCCTTTCCCCAACATCCTTTCCCCAACTTGTAGAGCGGTTCCCCAACTTGTAGAGCGGGCCTACCCAACTTGTAGAGCGGGCCTATTC

Full Affymetrix probeset data:

Annotations for 1634406_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime