FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634407_at:

>probe:Drosophila_2:1634407_at:266:245; Interrogation_Position=1011; Antisense; AATTATCTGCCCTTCATTGTTGAGC
>probe:Drosophila_2:1634407_at:574:579; Interrogation_Position=1085; Antisense; GGCCAAGGATCGGTCTTATCTATGT
>probe:Drosophila_2:1634407_at:233:529; Interrogation_Position=1129; Antisense; GGGACCAGCAACCTCAATAAGCTTA
>probe:Drosophila_2:1634407_at:296:167; Interrogation_Position=1180; Antisense; AAATGACTCCACTGTTCTGAACTGC
>probe:Drosophila_2:1634407_at:298:383; Interrogation_Position=1198; Antisense; GAACTGCACACCAACGATCAATCGG
>probe:Drosophila_2:1634407_at:584:131; Interrogation_Position=1224; Antisense; ACCGAACCATACATTCCACTTTGAT
>probe:Drosophila_2:1634407_at:624:195; Interrogation_Position=753; Antisense; AACTGGCTGGATGTGGTCAGACCGA
>probe:Drosophila_2:1634407_at:282:413; Interrogation_Position=772; Antisense; GACCGATTATTGAGGCACGCATGGA
>probe:Drosophila_2:1634407_at:641:199; Interrogation_Position=796; Antisense; AACGCTACAGCGTCGGTGAGATCCA
>probe:Drosophila_2:1634407_at:310:239; Interrogation_Position=825; Antisense; AATCTAATGGCCCTGGTCTCGGATC
>probe:Drosophila_2:1634407_at:429:641; Interrogation_Position=841; Antisense; TCTCGGATCGTCAGCGATGCTACGA
>probe:Drosophila_2:1634407_at:578:447; Interrogation_Position=872; Antisense; GATCCAAATGCTGGTCAACCTACCA
>probe:Drosophila_2:1634407_at:228:633; Interrogation_Position=931; Antisense; TCGCCAACCTAAGATCCCATGTGAG
>probe:Drosophila_2:1634407_at:485:359; Interrogation_Position=985; Antisense; GCAAGGAGAACATTCGTCGCCGCCA

Paste this into a BLAST search page for me
AATTATCTGCCCTTCATTGTTGAGCGGCCAAGGATCGGTCTTATCTATGTGGGACCAGCAACCTCAATAAGCTTAAAATGACTCCACTGTTCTGAACTGCGAACTGCACACCAACGATCAATCGGACCGAACCATACATTCCACTTTGATAACTGGCTGGATGTGGTCAGACCGAGACCGATTATTGAGGCACGCATGGAAACGCTACAGCGTCGGTGAGATCCAAATCTAATGGCCCTGGTCTCGGATCTCTCGGATCGTCAGCGATGCTACGAGATCCAAATGCTGGTCAACCTACCATCGCCAACCTAAGATCCCATGTGAGGCAAGGAGAACATTCGTCGCCGCCA

Full Affymetrix probeset data:

Annotations for 1634407_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720