Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634408_at:

>probe:Drosophila_2:1634408_at:730:159; Interrogation_Position=1476; Antisense; ACAACATCATGTTTCCGCTGGGACA
>probe:Drosophila_2:1634408_at:707:333; Interrogation_Position=1492; Antisense; GCTGGGACAGCTTCGCAACGAGCAG
>probe:Drosophila_2:1634408_at:93:579; Interrogation_Position=1644; Antisense; GGCCTCCAATGTCCTACGAAAATGT
>probe:Drosophila_2:1634408_at:481:87; Interrogation_Position=1675; Antisense; AGTCCTGAGCCGTCTGTGGGAAGCC
>probe:Drosophila_2:1634408_at:691:119; Interrogation_Position=1754; Antisense; AGCTGTTAGCCCTCGATTTAGACGG
>probe:Drosophila_2:1634408_at:439:405; Interrogation_Position=1774; Antisense; GACGGCAATTCGTAGGTCTCATTCT
>probe:Drosophila_2:1634408_at:381:537; Interrogation_Position=1788; Antisense; GGTCTCATTCTTATGCTAGCCTATA
>probe:Drosophila_2:1634408_at:510:217; Interrogation_Position=1816; Antisense; AAGTACACATTGCTCACTACACTAC
>probe:Drosophila_2:1634408_at:296:457; Interrogation_Position=1872; Antisense; GATACTCCTGATGTATGCCATTTTG
>probe:Drosophila_2:1634408_at:717:519; Interrogation_Position=1903; Antisense; GTGGATGCCGTGATCCTCATGTAAA
>probe:Drosophila_2:1634408_at:405:279; Interrogation_Position=1918; Antisense; CTCATGTAAATGTTCCCGTGGCAAT
>probe:Drosophila_2:1634408_at:290:121; Interrogation_Position=1946; Antisense; AGCGTAGCTCAACTGTGACTCAAGT
>probe:Drosophila_2:1634408_at:624:215; Interrogation_Position=1967; Antisense; AAGTTCTCAATAGATCGCGACGCAT
>probe:Drosophila_2:1634408_at:709:325; Interrogation_Position=1983; Antisense; GCGACGCATACATTTTTTCGGTGTA

Paste this into a BLAST search page for me
ACAACATCATGTTTCCGCTGGGACAGCTGGGACAGCTTCGCAACGAGCAGGGCCTCCAATGTCCTACGAAAATGTAGTCCTGAGCCGTCTGTGGGAAGCCAGCTGTTAGCCCTCGATTTAGACGGGACGGCAATTCGTAGGTCTCATTCTGGTCTCATTCTTATGCTAGCCTATAAAGTACACATTGCTCACTACACTACGATACTCCTGATGTATGCCATTTTGGTGGATGCCGTGATCCTCATGTAAACTCATGTAAATGTTCCCGTGGCAATAGCGTAGCTCAACTGTGACTCAAGTAAGTTCTCAATAGATCGCGACGCATGCGACGCATACATTTTTTCGGTGTA

Full Affymetrix probeset data:

Annotations for 1634408_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime