FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634409_at:

>probe:Drosophila_2:1634409_at:628:519; Interrogation_Position=164; Antisense; GTGGATTTGGTGATCAGCAGCAGCA
>probe:Drosophila_2:1634409_at:720:403; Interrogation_Position=27; Antisense; GACTAACCGAAGTATCAGCACCATG
>probe:Drosophila_2:1634409_at:41:205; Interrogation_Position=320; Antisense; AACCAATTCATAGCACCGTCTTAAC
>probe:Drosophila_2:1634409_at:191:131; Interrogation_Position=334; Antisense; ACCGTCTTAACGCAGATACCTCAAT
>probe:Drosophila_2:1634409_at:495:89; Interrogation_Position=37; Antisense; AGTATCAGCACCATGAAGTTTTTGA
>probe:Drosophila_2:1634409_at:569:145; Interrogation_Position=403; Antisense; ACTTTATCGTTCTCGAAAATTTATG
>probe:Drosophila_2:1634409_at:256:609; Interrogation_Position=494; Antisense; TACACTTAACATAAGGGACAACGGG
>probe:Drosophila_2:1634409_at:510:197; Interrogation_Position=513; Antisense; AACGGGAAATATCTTCTCTTTCAGA
>probe:Drosophila_2:1634409_at:250:217; Interrogation_Position=52; Antisense; AAGTTTTTGATCCTCTTCATTGCCC
>probe:Drosophila_2:1634409_at:485:275; Interrogation_Position=525; Antisense; CTTCTCTTTCAGATGTTCAAATGGT
>probe:Drosophila_2:1634409_at:229:207; Interrogation_Position=534; Antisense; CAGATGTTCAAATGGTTTTACTTAA
>probe:Drosophila_2:1634409_at:84:725; Interrogation_Position=58; Antisense; TTGATCCTCTTCATTGCCCTATTCG
>probe:Drosophila_2:1634409_at:522:333; Interrogation_Position=91; Antisense; GCTGCCCTACCTCAGTTTGGATTCG
>probe:Drosophila_2:1634409_at:397:673; Interrogation_Position=98; Antisense; TACCTCAGTTTGGATTCGGCGGTGG

Paste this into a BLAST search page for me
GTGGATTTGGTGATCAGCAGCAGCAGACTAACCGAAGTATCAGCACCATGAACCAATTCATAGCACCGTCTTAACACCGTCTTAACGCAGATACCTCAATAGTATCAGCACCATGAAGTTTTTGAACTTTATCGTTCTCGAAAATTTATGTACACTTAACATAAGGGACAACGGGAACGGGAAATATCTTCTCTTTCAGAAAGTTTTTGATCCTCTTCATTGCCCCTTCTCTTTCAGATGTTCAAATGGTCAGATGTTCAAATGGTTTTACTTAATTGATCCTCTTCATTGCCCTATTCGGCTGCCCTACCTCAGTTTGGATTCGTACCTCAGTTTGGATTCGGCGGTGG

Full Affymetrix probeset data:

Annotations for 1634409_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720