FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634410_at:

>probe:Drosophila_2:1634410_at:165:17; Interrogation_Position=1011; Antisense; ATTTGCTCACTTAACGTAGATCCCC
>probe:Drosophila_2:1634410_at:312:47; Interrogation_Position=474; Antisense; ATCCGGAGACCCAGTACAGCGATCT
>probe:Drosophila_2:1634410_at:175:195; Interrogation_Position=549; Antisense; AACGTGAATTGGAATCCTCCCACTC
>probe:Drosophila_2:1634410_at:124:285; Interrogation_Position=581; Antisense; CTGCTGAAGCTCTTCTCCGAGGAGA
>probe:Drosophila_2:1634410_at:166:437; Interrogation_Position=599; Antisense; GAGGAGAACTTGTCGACTGAACCAG
>probe:Drosophila_2:1634410_at:23:563; Interrogation_Position=658; Antisense; GGAAGATCAGGTGCCCATCGAGCTG
>probe:Drosophila_2:1634410_at:198:271; Interrogation_Position=673; Antisense; CATCGAGCTGGACCTATGTGACATC
>probe:Drosophila_2:1634410_at:429:511; Interrogation_Position=690; Antisense; GTGACATCCAACATACTACATCCGA
>probe:Drosophila_2:1634410_at:123:153; Interrogation_Position=707; Antisense; ACATCCGATGCTGGCGGTGAGGCAA
>probe:Drosophila_2:1634410_at:659:203; Interrogation_Position=740; Antisense; AAGCCAACGGAAAGTGTCGCCCAGT
>probe:Drosophila_2:1634410_at:316:203; Interrogation_Position=786; Antisense; AAGCGGAATCCTATGCCAAAGCCTG
>probe:Drosophila_2:1634410_at:209:673; Interrogation_Position=851; Antisense; TACGCCAAGCGCTCCATAGATGAAC
>probe:Drosophila_2:1634410_at:227:443; Interrogation_Position=869; Antisense; GATGAACTACTGGTCTTGGGTCGTC
>probe:Drosophila_2:1634410_at:669:415; Interrogation_Position=896; Antisense; GAGCGACTGAGCATTTCCACGGTCA

Paste this into a BLAST search page for me
ATTTGCTCACTTAACGTAGATCCCCATCCGGAGACCCAGTACAGCGATCTAACGTGAATTGGAATCCTCCCACTCCTGCTGAAGCTCTTCTCCGAGGAGAGAGGAGAACTTGTCGACTGAACCAGGGAAGATCAGGTGCCCATCGAGCTGCATCGAGCTGGACCTATGTGACATCGTGACATCCAACATACTACATCCGAACATCCGATGCTGGCGGTGAGGCAAAAGCCAACGGAAAGTGTCGCCCAGTAAGCGGAATCCTATGCCAAAGCCTGTACGCCAAGCGCTCCATAGATGAACGATGAACTACTGGTCTTGGGTCGTCGAGCGACTGAGCATTTCCACGGTCA

Full Affymetrix probeset data:

Annotations for 1634410_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720