Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634411_at:

>probe:Drosophila_2:1634411_at:473:351; Interrogation_Position=1004; Antisense; GCAGATGCTGTACGGCCTGCTCGAT
>probe:Drosophila_2:1634411_at:38:621; Interrogation_Position=1021; Antisense; TGCTCGATGGCCAGATATCGTCCAA
>probe:Drosophila_2:1634411_at:446:23; Interrogation_Position=1035; Antisense; ATATCGTCCAATACCTCCAACATGA
>probe:Drosophila_2:1634411_at:134:523; Interrogation_Position=1108; Antisense; GGGCCACGATTAGCAACTTTCACGC
>probe:Drosophila_2:1634411_at:430:675; Interrogation_Position=1118; Antisense; TAGCAACTTTCACGCCACTTTTGAA
>probe:Drosophila_2:1634411_at:585:31; Interrogation_Position=1166; Antisense; ATAACTTCATTATCTCACACTGAGA
>probe:Drosophila_2:1634411_at:28:383; Interrogation_Position=1226; Antisense; GAACGACTAAGATCTCTAGGCTCAA
>probe:Drosophila_2:1634411_at:629:649; Interrogation_Position=727; Antisense; TCACCCAGGTGCACAACTACTACAA
>probe:Drosophila_2:1634411_at:208:45; Interrogation_Position=772; Antisense; ATCGCGCGGAGATCGCTGAGTTCAA
>probe:Drosophila_2:1634411_at:493:429; Interrogation_Position=789; Antisense; GAGTTCAACAGCGTACTGCAGGAGT
>probe:Drosophila_2:1634411_at:213:261; Interrogation_Position=876; Antisense; CACGACTTTCTCAACATCCTGGACA
>probe:Drosophila_2:1634411_at:131:353; Interrogation_Position=913; Antisense; GCAGCAGCCAGAGCATAGGCGGCAT
>probe:Drosophila_2:1634411_at:92:315; Interrogation_Position=939; Antisense; GCCATGGGCGATATGCTGCAGGATC
>probe:Drosophila_2:1634411_at:383:83; Interrogation_Position=984; Antisense; AGTGGCACAGTCAGCTCCCAGCAGA

Paste this into a BLAST search page for me
GCAGATGCTGTACGGCCTGCTCGATTGCTCGATGGCCAGATATCGTCCAAATATCGTCCAATACCTCCAACATGAGGGCCACGATTAGCAACTTTCACGCTAGCAACTTTCACGCCACTTTTGAAATAACTTCATTATCTCACACTGAGAGAACGACTAAGATCTCTAGGCTCAATCACCCAGGTGCACAACTACTACAAATCGCGCGGAGATCGCTGAGTTCAAGAGTTCAACAGCGTACTGCAGGAGTCACGACTTTCTCAACATCCTGGACAGCAGCAGCCAGAGCATAGGCGGCATGCCATGGGCGATATGCTGCAGGATCAGTGGCACAGTCAGCTCCCAGCAGA

Full Affymetrix probeset data:

Annotations for 1634411_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime