Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634412_at:

>probe:Drosophila_2:1634412_at:87:203; Interrogation_Position=1755; Antisense; AACCTGTTGACGATAGAGGCCCAGA
>probe:Drosophila_2:1634412_at:169:471; Interrogation_Position=1793; Antisense; GTTCGGAAAGCCTGTCATCCAATTT
>probe:Drosophila_2:1634412_at:59:49; Interrogation_Position=1809; Antisense; ATCCAATTTGAGTACGGCGGCGACA
>probe:Drosophila_2:1634412_at:502:147; Interrogation_Position=1833; Antisense; ACTATGGAGGGCATGCACTCACTTC
>probe:Drosophila_2:1634412_at:463:563; Interrogation_Position=1877; Antisense; GGAATACCAGGTTGAGCTCTTCTCT
>probe:Drosophila_2:1634412_at:653:643; Interrogation_Position=1897; Antisense; TCTCTCGCCATTTCAAGGCTTTCGA
>probe:Drosophila_2:1634412_at:257:569; Interrogation_Position=1913; Antisense; GGCTTTCGACGAGTTACGCGGAAGA
>probe:Drosophila_2:1634412_at:578:429; Interrogation_Position=1953; Antisense; GAGTTTGTTTGGAACTTCGCCGATT
>probe:Drosophila_2:1634412_at:276:373; Interrogation_Position=2052; Antisense; GAAGTGGCTCACATTCTTAGGCGGC
>probe:Drosophila_2:1634412_at:468:329; Interrogation_Position=2075; Antisense; GCGGTACTTCGCATTAGCCAAGGAG
>probe:Drosophila_2:1634412_at:504:481; Interrogation_Position=2108; Antisense; GTTTGGGCTGCCTGAGGATCTCACT
>probe:Drosophila_2:1634412_at:671:543; Interrogation_Position=2123; Antisense; GGATCTCACTGTTTACATTTCCAAG
>probe:Drosophila_2:1634412_at:166:529; Interrogation_Position=2173; Antisense; GGGATACGTACAGCCAGAGTCTCAT
>probe:Drosophila_2:1634412_at:582:429; Interrogation_Position=2233; Antisense; GAGTTATTCACTACGCATTACATTA

Paste this into a BLAST search page for me
AACCTGTTGACGATAGAGGCCCAGAGTTCGGAAAGCCTGTCATCCAATTTATCCAATTTGAGTACGGCGGCGACAACTATGGAGGGCATGCACTCACTTCGGAATACCAGGTTGAGCTCTTCTCTTCTCTCGCCATTTCAAGGCTTTCGAGGCTTTCGACGAGTTACGCGGAAGAGAGTTTGTTTGGAACTTCGCCGATTGAAGTGGCTCACATTCTTAGGCGGCGCGGTACTTCGCATTAGCCAAGGAGGTTTGGGCTGCCTGAGGATCTCACTGGATCTCACTGTTTACATTTCCAAGGGGATACGTACAGCCAGAGTCTCATGAGTTATTCACTACGCATTACATTA

Full Affymetrix probeset data:

Annotations for 1634412_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime