Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634413_at:

>probe:Drosophila_2:1634413_at:449:477; Interrogation_Position=1898; Antisense; GTGTTATAAGTTACGACGCCTCCGG
>probe:Drosophila_2:1634413_at:21:265; Interrogation_Position=1977; Antisense; CAGCAGCATCAACTAGCTGAGCAAA
>probe:Drosophila_2:1634413_at:616:543; Interrogation_Position=2029; Antisense; GGATATAGGACAAAGGACCCCAATC
>probe:Drosophila_2:1634413_at:540:541; Interrogation_Position=2043; Antisense; GGACCCCAATCCTGGAAATCAGACT
>probe:Drosophila_2:1634413_at:4:559; Interrogation_Position=2056; Antisense; GGAAATCAGACTCCGGCGAAGTTTT
>probe:Drosophila_2:1634413_at:180:575; Interrogation_Position=2070; Antisense; GGCGAAGTTTTATGCTCGGACTCAT
>probe:Drosophila_2:1634413_at:426:51; Interrogation_Position=2081; Antisense; ATGCTCGGACTCATAAAATCGTGCG
>probe:Drosophila_2:1634413_at:221:237; Interrogation_Position=2097; Antisense; AATCGTGCGACGAGTTTGAATCACA
>probe:Drosophila_2:1634413_at:664:429; Interrogation_Position=2108; Antisense; GAGTTTGAATCACAGGCCCTCGATT
>probe:Drosophila_2:1634413_at:48:321; Interrogation_Position=2123; Antisense; GCCCTCGATTTTCACCAGGATTTTT
>probe:Drosophila_2:1634413_at:205:461; Interrogation_Position=2141; Antisense; GATTTTTTACAAATCCCAGCAGAAA
>probe:Drosophila_2:1634413_at:243:27; Interrogation_Position=2266; Antisense; ATAGCTAACTAGTTGTAACACTCAT
>probe:Drosophila_2:1634413_at:272:477; Interrogation_Position=2361; Antisense; GTTTAACTAGTCGTCTAAGCGAGAA
>probe:Drosophila_2:1634413_at:569:497; Interrogation_Position=2398; Antisense; GTCTAGCCATAAGTTTTAGCGCGAA

Paste this into a BLAST search page for me
GTGTTATAAGTTACGACGCCTCCGGCAGCAGCATCAACTAGCTGAGCAAAGGATATAGGACAAAGGACCCCAATCGGACCCCAATCCTGGAAATCAGACTGGAAATCAGACTCCGGCGAAGTTTTGGCGAAGTTTTATGCTCGGACTCATATGCTCGGACTCATAAAATCGTGCGAATCGTGCGACGAGTTTGAATCACAGAGTTTGAATCACAGGCCCTCGATTGCCCTCGATTTTCACCAGGATTTTTGATTTTTTACAAATCCCAGCAGAAAATAGCTAACTAGTTGTAACACTCATGTTTAACTAGTCGTCTAAGCGAGAAGTCTAGCCATAAGTTTTAGCGCGAA

Full Affymetrix probeset data:

Annotations for 1634413_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime