FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634414_at:

>probe:Drosophila_2:1634414_at:407:547; Interrogation_Position=112; Antisense; GGATGAAGCTAATCCGACCCACGGA
>probe:Drosophila_2:1634414_at:503:437; Interrogation_Position=135; Antisense; GAGGAACAGCCACCCAATGTGGTCA
>probe:Drosophila_2:1634414_at:52:229; Interrogation_Position=150; Antisense; AATGTGGTCACTTTTTCGGTGTCCA
>probe:Drosophila_2:1634414_at:50:671; Interrogation_Position=189; Antisense; TACGATGTGCGTAACTATCTGGAGA
>probe:Drosophila_2:1634414_at:316:453; Interrogation_Position=215; Antisense; GATCTACAAGCTGCCGGTGGTGGAT
>probe:Drosophila_2:1634414_at:250:547; Interrogation_Position=236; Antisense; GGATGTGCGTACTCGGATTGCCATG
>probe:Drosophila_2:1634414_at:76:449; Interrogation_Position=27; Antisense; GATCCTGGCTAGATCATGTCCACGA
>probe:Drosophila_2:1634414_at:709:369; Interrogation_Position=272; Antisense; GAAGGATCAGACCTACGGCTACATC
>probe:Drosophila_2:1634414_at:72:173; Interrogation_Position=303; Antisense; AAAGACGACGTGAAGCTGGCTTATG
>probe:Drosophila_2:1634414_at:99:277; Interrogation_Position=322; Antisense; CTTATGTAACATTGCCCAGGGAGGA
>probe:Drosophila_2:1634414_at:556:235; Interrogation_Position=418; Antisense; AATCGAAAGCCGGTTTCCGCAGATT
>probe:Drosophila_2:1634414_at:697:259; Interrogation_Position=470; Antisense; CACGCCGGGCTGGTTTTCCATTTAG
>probe:Drosophila_2:1634414_at:329:435; Interrogation_Position=50; Antisense; GAGGTGGTATCCCATCTATCAGCGC
>probe:Drosophila_2:1634414_at:649:701; Interrogation_Position=94; Antisense; TTTTCCTTCCCAACTTCTGGATGAA

Paste this into a BLAST search page for me
GGATGAAGCTAATCCGACCCACGGAGAGGAACAGCCACCCAATGTGGTCAAATGTGGTCACTTTTTCGGTGTCCATACGATGTGCGTAACTATCTGGAGAGATCTACAAGCTGCCGGTGGTGGATGGATGTGCGTACTCGGATTGCCATGGATCCTGGCTAGATCATGTCCACGAGAAGGATCAGACCTACGGCTACATCAAAGACGACGTGAAGCTGGCTTATGCTTATGTAACATTGCCCAGGGAGGAAATCGAAAGCCGGTTTCCGCAGATTCACGCCGGGCTGGTTTTCCATTTAGGAGGTGGTATCCCATCTATCAGCGCTTTTCCTTCCCAACTTCTGGATGAA

Full Affymetrix probeset data:

Annotations for 1634414_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720