Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634417_s_at:

>probe:Drosophila_2:1634417_s_at:235:553; Interrogation_Position=141; Antisense; GGAGCTAAATCTATCGTCGGCGGCC
>probe:Drosophila_2:1634417_s_at:224:69; Interrogation_Position=174; Antisense; AGGCGCCTTCCATTTGGGCAAGCAA
>probe:Drosophila_2:1634417_s_at:274:57; Interrogation_Position=215; Antisense; ATGAGTTTATGCTGTGCCGGCAGGA
>probe:Drosophila_2:1634417_s_at:490:305; Interrogation_Position=294; Antisense; CCTGGACTTCTTCCGCAAGGTGAAG
>probe:Drosophila_2:1634417_s_at:307:57; Interrogation_Position=329; Antisense; ATGAGGAGTTCACGCAGTACGCCAC
>probe:Drosophila_2:1634417_s_at:488:89; Interrogation_Position=344; Antisense; AGTACGCCACCTGCCTGGATAAGAG
>probe:Drosophila_2:1634417_s_at:394:681; Interrogation_Position=378; Antisense; TATGGCTTTTTCACATTGCCGCAAG
>probe:Drosophila_2:1634417_s_at:500:211; Interrogation_Position=400; Antisense; AAGACCCAGGGAGTGTTCGACAAGT
>probe:Drosophila_2:1634417_s_at:501:455; Interrogation_Position=433; Antisense; GATAACTTCGACTGGGATCGTCCCT
>probe:Drosophila_2:1634417_s_at:591:305; Interrogation_Position=458; Antisense; CCTATGGATACTTCTCGAGGGCCAA
>probe:Drosophila_2:1634417_s_at:561:223; Interrogation_Position=481; Antisense; AAGGTCATCCAATCAGCTCGGGAAG
>probe:Drosophila_2:1634417_s_at:102:77; Interrogation_Position=518; Antisense; AGGAGAAGGTCTCCTATCCCGATGC
>probe:Drosophila_2:1634417_s_at:50:337; Interrogation_Position=619; Antisense; GCTGCCAGCGCCTAGTGAAATTTGA
>probe:Drosophila_2:1634417_s_at:704:191; Interrogation_Position=663; Antisense; AACTCTTGTTTCCATTAGTACTCGA

Paste this into a BLAST search page for me
GGAGCTAAATCTATCGTCGGCGGCCAGGCGCCTTCCATTTGGGCAAGCAAATGAGTTTATGCTGTGCCGGCAGGACCTGGACTTCTTCCGCAAGGTGAAGATGAGGAGTTCACGCAGTACGCCACAGTACGCCACCTGCCTGGATAAGAGTATGGCTTTTTCACATTGCCGCAAGAAGACCCAGGGAGTGTTCGACAAGTGATAACTTCGACTGGGATCGTCCCTCCTATGGATACTTCTCGAGGGCCAAAAGGTCATCCAATCAGCTCGGGAAGAGGAGAAGGTCTCCTATCCCGATGCGCTGCCAGCGCCTAGTGAAATTTGAAACTCTTGTTTCCATTAGTACTCGA

Full Affymetrix probeset data:

Annotations for 1634417_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime