Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634418_at:

>probe:Drosophila_2:1634418_at:173:129; Interrogation_Position=1379; Antisense; ACCTGCGCCGTAAAGTTGATGCCGG
>probe:Drosophila_2:1634418_at:492:467; Interrogation_Position=1393; Antisense; GTTGATGCCGGTTTTCACTGAATCC
>probe:Drosophila_2:1634418_at:560:539; Interrogation_Position=1402; Antisense; GGTTTTCACTGAATCCCTAGGAATG
>probe:Drosophila_2:1634418_at:537:231; Interrogation_Position=1413; Antisense; AATCCCTAGGAATGCACGGAACCGT
>probe:Drosophila_2:1634418_at:596:139; Interrogation_Position=1428; Antisense; ACGGAACCGTCTTCATGTTTGCCAG
>probe:Drosophila_2:1634418_at:604:57; Interrogation_Position=1442; Antisense; ATGTTTGCCAGCTTATCCTTCCTAG
>probe:Drosophila_2:1634418_at:424:313; Interrogation_Position=1457; Antisense; TCCTTCCTAGCAGCAATTTTCATCG
>probe:Drosophila_2:1634418_at:176:245; Interrogation_Position=1471; Antisense; AATTTTCATCGCTATTTTCGTGCCC
>probe:Drosophila_2:1634418_at:525:635; Interrogation_Position=1479; Antisense; TCGCTATTTTCGTGCCCGAAACCAA
>probe:Drosophila_2:1634418_at:538:525; Interrogation_Position=1504; Antisense; GGGCAAGTCAGTTGATGCCATCTTG
>probe:Drosophila_2:1634418_at:522:627; Interrogation_Position=1519; Antisense; TGCCATCTTGGCCAGTCTCTAGTAC
>probe:Drosophila_2:1634418_at:532:727; Interrogation_Position=1526; Antisense; TTGGCCAGTCTCTAGTACCTATGAC
>probe:Drosophila_2:1634418_at:371:487; Interrogation_Position=1540; Antisense; GTACCTATGACTTATATTTAAACCA
>probe:Drosophila_2:1634418_at:523:7; Interrogation_Position=1571; Antisense; ATTGCTGTTAATAAATCCGCTAAGA

Paste this into a BLAST search page for me
ACCTGCGCCGTAAAGTTGATGCCGGGTTGATGCCGGTTTTCACTGAATCCGGTTTTCACTGAATCCCTAGGAATGAATCCCTAGGAATGCACGGAACCGTACGGAACCGTCTTCATGTTTGCCAGATGTTTGCCAGCTTATCCTTCCTAGTCCTTCCTAGCAGCAATTTTCATCGAATTTTCATCGCTATTTTCGTGCCCTCGCTATTTTCGTGCCCGAAACCAAGGGCAAGTCAGTTGATGCCATCTTGTGCCATCTTGGCCAGTCTCTAGTACTTGGCCAGTCTCTAGTACCTATGACGTACCTATGACTTATATTTAAACCAATTGCTGTTAATAAATCCGCTAAGA

Full Affymetrix probeset data:

Annotations for 1634418_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime