Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634419_at:

>probe:Drosophila_2:1634419_at:250:121; Interrogation_Position=1066; Antisense; AGCGGACGCCACTTCGACGTGGAGA
>probe:Drosophila_2:1634419_at:174:409; Interrogation_Position=1081; Antisense; GACGTGGAGACGTTCGCCAGCATCC
>probe:Drosophila_2:1634419_at:653:115; Interrogation_Position=1099; Antisense; AGCATCCTGTGCAAGTACTCGCGGT
>probe:Drosophila_2:1634419_at:183:681; Interrogation_Position=1144; Antisense; TAGGCACATCGTTCGCGTGGGTAGC
>probe:Drosophila_2:1634419_at:631:537; Interrogation_Position=1163; Antisense; GGTAGCGACACCCTTATATTAACTA
>probe:Drosophila_2:1634419_at:55:491; Interrogation_Position=1204; Antisense; GTAAATTATCGCCAGGAATTCCTTT
>probe:Drosophila_2:1634419_at:404:331; Interrogation_Position=679; Antisense; GCGGACACGGGCAGCTGCTTAAAGT
>probe:Drosophila_2:1634419_at:447:115; Interrogation_Position=691; Antisense; AGCTGCTTAAAGTGGCCACCCGTAG
>probe:Drosophila_2:1634419_at:119:63; Interrogation_Position=770; Antisense; ATGTGAACGGTTCACATTCCCCTCA
>probe:Drosophila_2:1634419_at:248:195; Interrogation_Position=794; Antisense; AACTGCAGCTCCATCAAATCAGCGC
>probe:Drosophila_2:1634419_at:539:139; Interrogation_Position=845; Antisense; ACGTCTGCCGCGAGTTGTACGAAGA
>probe:Drosophila_2:1634419_at:507:407; Interrogation_Position=876; Antisense; GACGGAGTTGGTGCAGAGCCTACTT
>probe:Drosophila_2:1634419_at:539:415; Interrogation_Position=891; Antisense; GAGCCTACTTAAGCAGAAGCGCGAA
>probe:Drosophila_2:1634419_at:389:153; Interrogation_Position=938; Antisense; ACATGCTGAGCAAGCGACTCGGGTT

Paste this into a BLAST search page for me
AGCGGACGCCACTTCGACGTGGAGAGACGTGGAGACGTTCGCCAGCATCCAGCATCCTGTGCAAGTACTCGCGGTTAGGCACATCGTTCGCGTGGGTAGCGGTAGCGACACCCTTATATTAACTAGTAAATTATCGCCAGGAATTCCTTTGCGGACACGGGCAGCTGCTTAAAGTAGCTGCTTAAAGTGGCCACCCGTAGATGTGAACGGTTCACATTCCCCTCAAACTGCAGCTCCATCAAATCAGCGCACGTCTGCCGCGAGTTGTACGAAGAGACGGAGTTGGTGCAGAGCCTACTTGAGCCTACTTAAGCAGAAGCGCGAAACATGCTGAGCAAGCGACTCGGGTT

Full Affymetrix probeset data:

Annotations for 1634419_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime