Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634421_at:

>probe:Drosophila_2:1634421_at:566:225; Interrogation_Position=2585; Antisense; AAGGACATGCGGTACTCCAATCTTC
>probe:Drosophila_2:1634421_at:101:471; Interrogation_Position=2622; Antisense; GTTCCTGCCTGACTGGAAATGCCAA
>probe:Drosophila_2:1634421_at:446:627; Interrogation_Position=2641; Antisense; TGCCAAATCTCTTACAGACTGCCAG
>probe:Drosophila_2:1634421_at:289:123; Interrogation_Position=2664; Antisense; AGCCGTTGGGAGTGTCTTTGGAATC
>probe:Drosophila_2:1634421_at:101:129; Interrogation_Position=2708; Antisense; ACCAGCAAGAATTACTCGCGCGAAG
>probe:Drosophila_2:1634421_at:206:483; Interrogation_Position=2762; Antisense; GTATATCTGTGCCATCACGGAGCAG
>probe:Drosophila_2:1634421_at:606:347; Interrogation_Position=2783; Antisense; GCAGGTCTGCCCCAATGTTTGGGAA
>probe:Drosophila_2:1634421_at:436:241; Interrogation_Position=2806; Antisense; AATAGGTGTGGTTCGCGCCATCGAC
>probe:Drosophila_2:1634421_at:188:225; Interrogation_Position=2840; Antisense; AAGGAGTTATACCTGGTGCCAGCAA
>probe:Drosophila_2:1634421_at:677:49; Interrogation_Position=2864; Antisense; ATGCCGCTACAAAAGATGTCCCTGG
>probe:Drosophila_2:1634421_at:187:571; Interrogation_Position=2930; Antisense; GGCTTCCTTCGGGATCAGGGCCAAG
>probe:Drosophila_2:1634421_at:560:647; Interrogation_Position=2944; Antisense; TCAGGGCCAAGGTGTGTCCAGCAGT
>probe:Drosophila_2:1634421_at:189:291; Interrogation_Position=2977; Antisense; CGTGTTCATCCTTGACGATTCGAAA
>probe:Drosophila_2:1634421_at:21:431; Interrogation_Position=3010; Antisense; GAGTATTCAGCAGATCTACCATCGA

Paste this into a BLAST search page for me
AAGGACATGCGGTACTCCAATCTTCGTTCCTGCCTGACTGGAAATGCCAATGCCAAATCTCTTACAGACTGCCAGAGCCGTTGGGAGTGTCTTTGGAATCACCAGCAAGAATTACTCGCGCGAAGGTATATCTGTGCCATCACGGAGCAGGCAGGTCTGCCCCAATGTTTGGGAAAATAGGTGTGGTTCGCGCCATCGACAAGGAGTTATACCTGGTGCCAGCAAATGCCGCTACAAAAGATGTCCCTGGGGCTTCCTTCGGGATCAGGGCCAAGTCAGGGCCAAGGTGTGTCCAGCAGTCGTGTTCATCCTTGACGATTCGAAAGAGTATTCAGCAGATCTACCATCGA

Full Affymetrix probeset data:

Annotations for 1634421_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime