Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634422_at:

>probe:Drosophila_2:1634422_at:402:637; Interrogation_Position=3922; Antisense; TCGAGAGTGGCTTTCCTGGTCGCCG
>probe:Drosophila_2:1634422_at:704:535; Interrogation_Position=3939; Antisense; GGTCGCCGGCGAGATGATGTTTATC
>probe:Drosophila_2:1634422_at:439:607; Interrogation_Position=3953; Antisense; TGATGTTTATCGGATCGCTGCAGCA
>probe:Drosophila_2:1634422_at:270:353; Interrogation_Position=3972; Antisense; GCAGCAGGTGCGATCAGAAGTATCT
>probe:Drosophila_2:1634422_at:192:213; Interrogation_Position=4011; Antisense; AAGGCTTAGGGTCAATCCCAGTGAC
>probe:Drosophila_2:1634422_at:549:633; Interrogation_Position=4026; Antisense; TCCCAGTGACGGAAACGAAGCCCTT
>probe:Drosophila_2:1634422_at:450:297; Interrogation_Position=4041; Antisense; CGAAGCCCTTGAAACTTGTCTCATA
>probe:Drosophila_2:1634422_at:699:11; Interrogation_Position=4078; Antisense; ATTAATGTTACAACGTTGGCCAACT
>probe:Drosophila_2:1634422_at:210:467; Interrogation_Position=4092; Antisense; GTTGGCCAACTTGTTCTACCAAATG
>probe:Drosophila_2:1634422_at:219:437; Interrogation_Position=4144; Antisense; GAGGACTATTCCATAACGCAGGTTT
>probe:Drosophila_2:1634422_at:485:659; Interrogation_Position=4157; Antisense; TAACGCAGGTTTCCTTGGACGAAAT
>probe:Drosophila_2:1634422_at:202:47; Interrogation_Position=4208; Antisense; ATCCGAATCTCGTAGACCTAGACTC
>probe:Drosophila_2:1634422_at:651:413; Interrogation_Position=4222; Antisense; GACCTAGACTCTACTCATAATAGCG
>probe:Drosophila_2:1634422_at:696:217; Interrogation_Position=4422; Antisense; AAGTCCCGCAACTCAATCTGATAGT

Paste this into a BLAST search page for me
TCGAGAGTGGCTTTCCTGGTCGCCGGGTCGCCGGCGAGATGATGTTTATCTGATGTTTATCGGATCGCTGCAGCAGCAGCAGGTGCGATCAGAAGTATCTAAGGCTTAGGGTCAATCCCAGTGACTCCCAGTGACGGAAACGAAGCCCTTCGAAGCCCTTGAAACTTGTCTCATAATTAATGTTACAACGTTGGCCAACTGTTGGCCAACTTGTTCTACCAAATGGAGGACTATTCCATAACGCAGGTTTTAACGCAGGTTTCCTTGGACGAAATATCCGAATCTCGTAGACCTAGACTCGACCTAGACTCTACTCATAATAGCGAAGTCCCGCAACTCAATCTGATAGT

Full Affymetrix probeset data:

Annotations for 1634422_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime