FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634427_at:

>probe:Drosophila_2:1634427_at:401:173; Interrogation_Position=128; Antisense; AAACCAAAACACTTCAGCTGCTGCT
>probe:Drosophila_2:1634427_at:208:621; Interrogation_Position=146; Antisense; TGCTGCTAATGGCTCGCGCCGTATT
>probe:Drosophila_2:1634427_at:278:477; Interrogation_Position=16; Antisense; GTTATTTTGGAGAGCACACACATCA
>probe:Drosophila_2:1634427_at:74:323; Interrogation_Position=161; Antisense; GCGCCGTATTGACGATCATCTATAA
>probe:Drosophila_2:1634427_at:459:685; Interrogation_Position=181; Antisense; TATAATGACCACTTCTGCTGGACCT
>probe:Drosophila_2:1634427_at:610:149; Interrogation_Position=191; Antisense; ACTTCTGCTGGACCTTCATAAAGAG
>probe:Drosophila_2:1634427_at:163:173; Interrogation_Position=210; Antisense; AAAGAGCTATGGACTCTTCTCGCTG
>probe:Drosophila_2:1634427_at:518:581; Interrogation_Position=233; Antisense; TGGCGATTCCGCTGGCCAAGTACTT
>probe:Drosophila_2:1634427_at:208:217; Interrogation_Position=250; Antisense; AAGTACTTCGATGGCTTCCAAGTGT
>probe:Drosophila_2:1634427_at:565:219; Interrogation_Position=269; Antisense; AAGTGTTGCCCACCGGTGACGTGTA
>probe:Drosophila_2:1634427_at:241:535; Interrogation_Position=283; Antisense; GGTGACGTGTAATTTTCAGCCAATT
>probe:Drosophila_2:1634427_at:674:429; Interrogation_Position=65; Antisense; GAGTCCACATAGTTTTCGTTCCCGT
>probe:Drosophila_2:1634427_at:43:471; Interrogation_Position=82; Antisense; GTTCCCGTTGAGTCGAGCAATCAGT
>probe:Drosophila_2:1634427_at:356:249; Interrogation_Position=99; Antisense; CAATCAGTTTTGTGGCGCTATGGTG

Paste this into a BLAST search page for me
AAACCAAAACACTTCAGCTGCTGCTTGCTGCTAATGGCTCGCGCCGTATTGTTATTTTGGAGAGCACACACATCAGCGCCGTATTGACGATCATCTATAATATAATGACCACTTCTGCTGGACCTACTTCTGCTGGACCTTCATAAAGAGAAAGAGCTATGGACTCTTCTCGCTGTGGCGATTCCGCTGGCCAAGTACTTAAGTACTTCGATGGCTTCCAAGTGTAAGTGTTGCCCACCGGTGACGTGTAGGTGACGTGTAATTTTCAGCCAATTGAGTCCACATAGTTTTCGTTCCCGTGTTCCCGTTGAGTCGAGCAATCAGTCAATCAGTTTTGTGGCGCTATGGTG

Full Affymetrix probeset data:

Annotations for 1634427_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720