FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634428_at:

>probe:Drosophila_2:1634428_at:681:479; Interrogation_Position=1352; Antisense; GTTTGCCGCTATACTTTATGACCTT
>probe:Drosophila_2:1634428_at:619:27; Interrogation_Position=1362; Antisense; ATACTTTATGACCTTCCACGGACAG
>probe:Drosophila_2:1634428_at:557:203; Interrogation_Position=1396; Antisense; AAGCCGGTTCTGGAAGCCATCGAGC
>probe:Drosophila_2:1634428_at:10:43; Interrogation_Position=1414; Antisense; ATCGAGCATGCGTCGTATGTGCACG
>probe:Drosophila_2:1634428_at:6:59; Interrogation_Position=1474; Antisense; ATGATGGGCGTGTCCACATTTCGAG
>probe:Drosophila_2:1634428_at:183:557; Interrogation_Position=1518; Antisense; GGACTCTATTATAGCTGCCTTTCGC
>probe:Drosophila_2:1634428_at:308:511; Interrogation_Position=1570; Antisense; GTGACACTCGTAATGCATCCGCGCA
>probe:Drosophila_2:1634428_at:220:263; Interrogation_Position=1623; Antisense; CAGCTCGGTTTTCGGCACAGCAAAG
>probe:Drosophila_2:1634428_at:66:107; Interrogation_Position=1683; Antisense; AGACAAGAGGCTGACTTCTGTGCGG
>probe:Drosophila_2:1634428_at:18:211; Interrogation_Position=1732; Antisense; AAGAATCGTTATTCCGGCGACCTGG
>probe:Drosophila_2:1634428_at:91:347; Interrogation_Position=1757; Antisense; GCATCATGCCACTGGAATTCGACAA
>probe:Drosophila_2:1634428_at:625:397; Interrogation_Position=1777; Antisense; GACAAAGACGGCTTGAGCTACTCAA
>probe:Drosophila_2:1634428_at:482:117; Interrogation_Position=1792; Antisense; AGCTACTCAACCCAGATCCAAAATG
>probe:Drosophila_2:1634428_at:630:387; Interrogation_Position=1831; Antisense; GAAAAGACGCCATCCGAGAACTGAT

Paste this into a BLAST search page for me
GTTTGCCGCTATACTTTATGACCTTATACTTTATGACCTTCCACGGACAGAAGCCGGTTCTGGAAGCCATCGAGCATCGAGCATGCGTCGTATGTGCACGATGATGGGCGTGTCCACATTTCGAGGGACTCTATTATAGCTGCCTTTCGCGTGACACTCGTAATGCATCCGCGCACAGCTCGGTTTTCGGCACAGCAAAGAGACAAGAGGCTGACTTCTGTGCGGAAGAATCGTTATTCCGGCGACCTGGGCATCATGCCACTGGAATTCGACAAGACAAAGACGGCTTGAGCTACTCAAAGCTACTCAACCCAGATCCAAAATGGAAAAGACGCCATCCGAGAACTGAT

Full Affymetrix probeset data:

Annotations for 1634428_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720