FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634429_at:

>probe:Drosophila_2:1634429_at:296:103; Interrogation_Position=108; Antisense; AGAGCCTGGATCCTTCGATTCAAGA
>probe:Drosophila_2:1634429_at:655:213; Interrogation_Position=129; Antisense; AAGAGATCATCCTGGCAGCCACGGA
>probe:Drosophila_2:1634429_at:65:189; Interrogation_Position=162; Antisense; AACAGGCTTATTGTCCGTACAGTAA
>probe:Drosophila_2:1634429_at:324:665; Interrogation_Position=179; Antisense; TACAGTAACTTTGCCGTAGGAGCCG
>probe:Drosophila_2:1634429_at:608:67; Interrogation_Position=219; Antisense; ATGGCACCATATACTCCGGTTGCAA
>probe:Drosophila_2:1634429_at:255:485; Interrogation_Position=259; Antisense; GTATGCCACCTGCATTTGTGCAGAG
>probe:Drosophila_2:1634429_at:32:177; Interrogation_Position=317; Antisense; AAACGCGACTTTGTGGCTTGTGCAG
>probe:Drosophila_2:1634429_at:192:31; Interrogation_Position=357; Antisense; ATAATGGCTTCACCACGCCTTGTGG
>probe:Drosophila_2:1634429_at:411:91; Interrogation_Position=393; Antisense; AGTTCCTCTCGGAGTTCGTCAACGG
>probe:Drosophila_2:1634429_at:251:239; Interrogation_Position=452; Antisense; AATCTTCCATTGAGGGTGCTCTGCA
>probe:Drosophila_2:1634429_at:40:663; Interrogation_Position=527; Antisense; TAGAAAAGAATATCCCAGCCCAGCC
>probe:Drosophila_2:1634429_at:623:125; Interrogation_Position=553; Antisense; AGCCGGACAGGGTGCAATCCATGTG
>probe:Drosophila_2:1634429_at:63:687; Interrogation_Position=602; Antisense; TATAATGTTCTGTAAACCCACCCCT
>probe:Drosophila_2:1634429_at:221:305; Interrogation_Position=619; Antisense; CCACCCCTCGTTATTTGTTGATTGA

Paste this into a BLAST search page for me
AGAGCCTGGATCCTTCGATTCAAGAAAGAGATCATCCTGGCAGCCACGGAAACAGGCTTATTGTCCGTACAGTAATACAGTAACTTTGCCGTAGGAGCCGATGGCACCATATACTCCGGTTGCAAGTATGCCACCTGCATTTGTGCAGAGAAACGCGACTTTGTGGCTTGTGCAGATAATGGCTTCACCACGCCTTGTGGAGTTCCTCTCGGAGTTCGTCAACGGAATCTTCCATTGAGGGTGCTCTGCATAGAAAAGAATATCCCAGCCCAGCCAGCCGGACAGGGTGCAATCCATGTGTATAATGTTCTGTAAACCCACCCCTCCACCCCTCGTTATTTGTTGATTGA

Full Affymetrix probeset data:

Annotations for 1634429_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720