FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634431_at:

>probe:Drosophila_2:1634431_at:565:187; Interrogation_Position=132; Antisense; AACACCTACCGCCATTCTGTGTGAA
>probe:Drosophila_2:1634431_at:582:11; Interrogation_Position=145; Antisense; ATTCTGTGTGAATTGACGCGCCTGA
>probe:Drosophila_2:1634431_at:638:433; Interrogation_Position=241; Antisense; GAGGGCACAGATTCAAAGACCGAGT
>probe:Drosophila_2:1634431_at:284:431; Interrogation_Position=262; Antisense; GAGTCTTGCCAAGAGCCGGAAACTG
>probe:Drosophila_2:1634431_at:304:469; Interrogation_Position=308; Antisense; GTTCCTCCACGGCAGATCTAATAGG
>probe:Drosophila_2:1634431_at:511:389; Interrogation_Position=357; Antisense; GAAACTTGTGCTCCATGAAAAACTT
>probe:Drosophila_2:1634431_at:386:425; Interrogation_Position=407; Antisense; GAGAGCTTCAGGATATGTGGCATTT
>probe:Drosophila_2:1634431_at:719:343; Interrogation_Position=426; Antisense; GCATTTTGTGGCCACCGTTAAGGAG
>probe:Drosophila_2:1634431_at:474:221; Interrogation_Position=445; Antisense; AAGGAGGATGTCTTTCGGCCAGAAC
>probe:Drosophila_2:1634431_at:590:311; Interrogation_Position=462; Antisense; GCCAGAACGTCTTAGCCAATATACA
>probe:Drosophila_2:1634431_at:501:107; Interrogation_Position=505; Antisense; AGAATCGTTGGCCTAAATGCCCAAT
>probe:Drosophila_2:1634431_at:543:233; Interrogation_Position=520; Antisense; AATGCCCAATTGTATCGCTTGGCTG
>probe:Drosophila_2:1634431_at:629:43; Interrogation_Position=533; Antisense; ATCGCTTGGCTGCTAGGAACTCAAA
>probe:Drosophila_2:1634431_at:203:251; Interrogation_Position=94; Antisense; CAAGTTAAAATTCCGCCCAAGATCA

Paste this into a BLAST search page for me
AACACCTACCGCCATTCTGTGTGAAATTCTGTGTGAATTGACGCGCCTGAGAGGGCACAGATTCAAAGACCGAGTGAGTCTTGCCAAGAGCCGGAAACTGGTTCCTCCACGGCAGATCTAATAGGGAAACTTGTGCTCCATGAAAAACTTGAGAGCTTCAGGATATGTGGCATTTGCATTTTGTGGCCACCGTTAAGGAGAAGGAGGATGTCTTTCGGCCAGAACGCCAGAACGTCTTAGCCAATATACAAGAATCGTTGGCCTAAATGCCCAATAATGCCCAATTGTATCGCTTGGCTGATCGCTTGGCTGCTAGGAACTCAAACAAGTTAAAATTCCGCCCAAGATCA

Full Affymetrix probeset data:

Annotations for 1634431_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720