FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634433_at:

>probe:Drosophila_2:1634433_at:289:403; Interrogation_Position=467; Antisense; GACTTCCAGCGGGTGATCAACATCA
>probe:Drosophila_2:1634433_at:117:455; Interrogation_Position=481; Antisense; GATCAACATCAATACCGTGGGCACG
>probe:Drosophila_2:1634433_at:642:567; Interrogation_Position=500; Antisense; GGCACGTTCAATGTGATCCGTCTGT
>probe:Drosophila_2:1634433_at:660:399; Interrogation_Position=564; Antisense; GACAGCGCGGCGTGATCGTGAACAC
>probe:Drosophila_2:1634433_at:630:531; Interrogation_Position=595; Antisense; GGTGGCTGCCTTTGATGGCCAGATC
>probe:Drosophila_2:1634433_at:286:511; Interrogation_Position=681; Antisense; GTGACTTGAGCACCCAGGGCATACG
>probe:Drosophila_2:1634433_at:7:83; Interrogation_Position=696; Antisense; AGGGCATACGTATCTGCACCATTGC
>probe:Drosophila_2:1634433_at:532:7; Interrogation_Position=716; Antisense; ATTGCACCGGGTTTGTTCAACACGC
>probe:Drosophila_2:1634433_at:57:593; Interrogation_Position=837; Antisense; TGGTGCAGGCCATCTACGAGAATCC
>probe:Drosophila_2:1634433_at:25:195; Interrogation_Position=869; Antisense; AACGGCGAGGTCATCCGTATCGACG
>probe:Drosophila_2:1634433_at:169:483; Interrogation_Position=885; Antisense; GTATCGACGGTGCTCTGCGCATGAT
>probe:Drosophila_2:1634433_at:90:59; Interrogation_Position=905; Antisense; ATGATGCCCTAGATCCGGCTGAGCA
>probe:Drosophila_2:1634433_at:103:609; Interrogation_Position=924; Antisense; TGAGCACTGTCTTGGACCTGTGGAA
>probe:Drosophila_2:1634433_at:172:373; Interrogation_Position=946; Antisense; GAAGTGGCTCGATCAGTTTGCATTT

Paste this into a BLAST search page for me
GACTTCCAGCGGGTGATCAACATCAGATCAACATCAATACCGTGGGCACGGGCACGTTCAATGTGATCCGTCTGTGACAGCGCGGCGTGATCGTGAACACGGTGGCTGCCTTTGATGGCCAGATCGTGACTTGAGCACCCAGGGCATACGAGGGCATACGTATCTGCACCATTGCATTGCACCGGGTTTGTTCAACACGCTGGTGCAGGCCATCTACGAGAATCCAACGGCGAGGTCATCCGTATCGACGGTATCGACGGTGCTCTGCGCATGATATGATGCCCTAGATCCGGCTGAGCATGAGCACTGTCTTGGACCTGTGGAAGAAGTGGCTCGATCAGTTTGCATTT

Full Affymetrix probeset data:

Annotations for 1634433_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720