FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634434_at:

>probe:Drosophila_2:1634434_at:705:441; Interrogation_Position=1029; Antisense; GATGGTGACGTCTATGGATTGCTCA
>probe:Drosophila_2:1634434_at:649:541; Interrogation_Position=1044; Antisense; GGATTGCTCAATGTGTCGCACGTAG
>probe:Drosophila_2:1634434_at:29:591; Interrogation_Position=1110; Antisense; TGGTTCGAATACGTCGCAGCTGCAA
>probe:Drosophila_2:1634434_at:487:553; Interrogation_Position=1160; Antisense; GGAGCTATTACACCCATGCTTACAT
>probe:Drosophila_2:1634434_at:39:277; Interrogation_Position=1178; Antisense; CTTACATTCCCATCTGCAACAGAGA
>probe:Drosophila_2:1634434_at:185:531; Interrogation_Position=675; Antisense; GGGTTCATCACTTTCGATAGTCGAC
>probe:Drosophila_2:1634434_at:380:717; Interrogation_Position=701; Antisense; TTCGTCGTGCTTCATTGGATGCGTA
>probe:Drosophila_2:1634434_at:129:445; Interrogation_Position=718; Antisense; GATGCGTACGTTCAGCGGATTCAGT
>probe:Drosophila_2:1634434_at:252:39; Interrogation_Position=815; Antisense; ATCTGAATGGGCTTCGATTGGGCGC
>probe:Drosophila_2:1634434_at:247:3; Interrogation_Position=831; Antisense; ATTGGGCGCCGTAGTTGCCTAGAGA
>probe:Drosophila_2:1634434_at:683:5; Interrogation_Position=872; Antisense; ATTGCACTTTGTCTCGTGTTGCAGA
>probe:Drosophila_2:1634434_at:593:259; Interrogation_Position=914; Antisense; CACCATTAGGTTGGGCATTCGCAAT
>probe:Drosophila_2:1634434_at:608:629; Interrogation_Position=962; Antisense; TCCATTCCATTCAGGTGTGCTGCAA
>probe:Drosophila_2:1634434_at:400:423; Interrogation_Position=990; Antisense; GAGACACTTACGCTTCAGCTGATTG

Paste this into a BLAST search page for me
GATGGTGACGTCTATGGATTGCTCAGGATTGCTCAATGTGTCGCACGTAGTGGTTCGAATACGTCGCAGCTGCAAGGAGCTATTACACCCATGCTTACATCTTACATTCCCATCTGCAACAGAGAGGGTTCATCACTTTCGATAGTCGACTTCGTCGTGCTTCATTGGATGCGTAGATGCGTACGTTCAGCGGATTCAGTATCTGAATGGGCTTCGATTGGGCGCATTGGGCGCCGTAGTTGCCTAGAGAATTGCACTTTGTCTCGTGTTGCAGACACCATTAGGTTGGGCATTCGCAATTCCATTCCATTCAGGTGTGCTGCAAGAGACACTTACGCTTCAGCTGATTG

Full Affymetrix probeset data:

Annotations for 1634434_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720