FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634436_at:

>probe:Drosophila_2:1634436_at:238:177; Interrogation_Position=1034; Antisense; AAACTGCATTCCTCAATGTGTGTGC
>probe:Drosophila_2:1634436_at:653:273; Interrogation_Position=1040; Antisense; CATTCCTCAATGTGTGTGCTTTTGT
>probe:Drosophila_2:1634436_at:313:221; Interrogation_Position=1071; Antisense; AAGTGTCCCAGCTAATGTATAATAC
>probe:Drosophila_2:1634436_at:418:563; Interrogation_Position=1117; Antisense; GGAATGCAAACTTGGTGTCATCTAA
>probe:Drosophila_2:1634436_at:31:599; Interrogation_Position=1132; Antisense; TGTCATCTAATACCTCCTACACAAA
>probe:Drosophila_2:1634436_at:365:675; Interrogation_Position=633; Antisense; TAGGAAGTAAGTTCCCGGACAGTGG
>probe:Drosophila_2:1634436_at:466:109; Interrogation_Position=660; Antisense; AGAATATCCGGAACCCAGAGCTCTT
>probe:Drosophila_2:1634436_at:172:561; Interrogation_Position=669; Antisense; GGAACCCAGAGCTCTTGGTTAAACT
>probe:Drosophila_2:1634436_at:56:205; Interrogation_Position=733; Antisense; AAGCCACAACACAAAGATTAGCATA
>probe:Drosophila_2:1634436_at:55:207; Interrogation_Position=793; Antisense; AAGCTAAGACTCAACTATATCCATA
>probe:Drosophila_2:1634436_at:108:191; Interrogation_Position=831; Antisense; AACTTATCCTTTGAATGTCTACGAA
>probe:Drosophila_2:1634436_at:464:59; Interrogation_Position=868; Antisense; ATGTTCGTTCCATTGTAGTTGCCAA
>probe:Drosophila_2:1634436_at:104:479; Interrogation_Position=961; Antisense; GTTTCTTGATTTACGCTTTGCATAT
>probe:Drosophila_2:1634436_at:226:671; Interrogation_Position=972; Antisense; TACGCTTTGCATATGGTGTGGTAAA

Paste this into a BLAST search page for me
AAACTGCATTCCTCAATGTGTGTGCCATTCCTCAATGTGTGTGCTTTTGTAAGTGTCCCAGCTAATGTATAATACGGAATGCAAACTTGGTGTCATCTAATGTCATCTAATACCTCCTACACAAATAGGAAGTAAGTTCCCGGACAGTGGAGAATATCCGGAACCCAGAGCTCTTGGAACCCAGAGCTCTTGGTTAAACTAAGCCACAACACAAAGATTAGCATAAAGCTAAGACTCAACTATATCCATAAACTTATCCTTTGAATGTCTACGAAATGTTCGTTCCATTGTAGTTGCCAAGTTTCTTGATTTACGCTTTGCATATTACGCTTTGCATATGGTGTGGTAAA

Full Affymetrix probeset data:

Annotations for 1634436_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720